Description :
From Genome Similarity Track
Location :
contig_22:96449- 99055
Transcript NameFunction/comments
g5569.t1hypothetical protein
g5570.t1hypothetical protein

Sequence
2606 bases(100 bases per row)
AAATATGCTAAATACTCACTGTTATGCTTGGCGTGCTCTTCGTCCAGCTCGCTGTCGTCGATCATCGACCCAAGCTCACAATTCCAGCAAACGTTCTCGT
CGCCATTCTCTCTCGCGCACTTTCTGTGAAAATATTTCGTGCAGGTTGGACAGCGCACTAATCTGGACGGCAGCCCGGTTTCTTCGCACAGCTCGCACAT
GACCTTCTCTGGGCGTGTTCGCGTACGCTCACTACCGAGCGTCGGAACATACCACGTTCGATTTCCTGACACGGGTGTTGTCGGGATCGCCACAGGTAGA
CCTGTACCTTTCATTTGAGTGTTAGCAGGCAGGCCATGCTTCAGCGTAGCTGTAGTTGCTACACTTGCTCGTGGAGTAGGCATCGGTGACTCTGCGTCGC
TATCCTCCGAGTCGCTCAGGTTTGTCAAGTCCACAACGTCTAGAAGTTTTAGCTGGGATCGGCTCACCTCTTCAGGGTCATCGTCTTCCTCGGCATCTTC
ATCTCCACACTCACGCATAAACGCCAGAAATTCAGGACTGCAATATCCTAGGATAGGGGGCTCCACAGGAGTCATTTCAAGTGGCGCGGCGTTGACCTTG
ACGAATAGAACTGCATCTCCATCAGCAGAGTCTGTAACGATTGGTGAGGGCTTTGTCCGCTGCTGAGCCTCATCGGTGCGCTTCATTCCTTCAGGGTGCT
TCTTTTTTGGCAATAGTACATTAGTAAAAGTACCCGCTTTCGTCATGTCAGCATTCCTGTTGGTGGGAGAAGATACCTTCGTTGCGGCAGGCTTTACGAT
AGCGATACCTTCAGCCGAAGAGTACGGTACTGCTGCTGCATTTGTCGACGGGTTCGTAGTGACTGGTGCCAGCCTTGACGTCGCTGGCGCGGGTACCGAT
AGAGATATTGATGGTACTCCTGATATCATGGCAGTTTGAGCTACCTCTGTCGGCACTGGTGAAGACGCTGGTGCGGGCGGTATTCCGGTTTTTGCTACCG
CTGCTACCTTTGTCTTCACTTGTGACGTTGTTGGCATAACTGCTGAGCTCCCTTGAGCAGGTTTGGAAAATGTCGGCGCTACTTGTACAGGCGTTGGCTT
CAAAACTGCAGGTGGCAGCACTGCAACGGTCGGTGATACCAGATCCGGTTTAGATGACGGTCGAGGTGGGTTTGAACTTGGAAGCGGTGCAGGCGGTGCC
GAAGATTGTGCAGGTGTTGGTGCTGCCGGTGCTGCTACTACTGTCTTCAGCGATGGTACCGTTAGTACTCCGGGTGCTTTGATTGGGTTCGTGGCAGCGT
TTGCGGCTGGTTTTGCTTCAGAAATGGTTTTTTTAGTTGTGTCTGGAGGTGCTGTTGATGGCGCCTCCAGTCCCATTACTTCATTTGCGCTAGGACCCGC
AGATACCGTTGCTGCGGCTGGTCCCACAGACGTTGAACTTGTCGCCTTCGAAGACGCCGATGAATTCGCTTTCAGAGCCGGTGGTTGGCTTCGTCGGGCC
ACCGCCAGGCCATCGAACACAGTAACGAAGTCCGACGCCTGGAACTCAACGGCGTCGAACGCTCGAGATTGGAAAAACGGGTCCTCCTCCTCGCTTCTCG
ATACCACCTGCACTGCGCCCGTCTCTAGTTGCACTGCATTCTTCACTGCTGCGTCTGTTGGAGCAGTCGAAGCAGGGGCCTCGATACCTGTTGCTTCTCC
TGAATCCGTCAGTTTAGCCTTCCCCTGCTCTTTTTTATCTGCAGGCGGTGGTCTCGGCTCCACTGACTTGGGATCTACCGGTTTCGCTTGAGCAGGTCGA
ATCACCTGCATCGGTTGGGACACCACCGCCTTAACAGCATTTGCAGCTGCAGGGTGCGAGCGCGCGGCACCTCCATCTGCTGCGTGCTTCCTCATCACGG
CTACCTGCTCCATCGACGGGAAGTCGCTCTCTTTGAAGAATACCGTCGGGAACACCCGACTCTGGAATAACTCACGTTGCCCGCTGGCATCCCCATGATT
TTCTTTTTCTCTCCTGCTCGTGGCCTTCTGCACCACTACTTGGTCCTCCTCGTCGTCCGAGATGAGGTCGATCACGTCCGGCTGCGGTCTCTTCTTTGAG
GTATTTTTGGTCTCCTCGTACCTCCTCTTCTTGCCATTTGAGTGCACCGCATCCTCACGCAGCCGATTGGTTGAGGCACTCGTGTGGCTTTTGGCCTGGT
CGCTGCGCCTGGACACTGCAGTCTTGGAGCGGCACTTGTCGCACTCCTCGTGTTCCGAGCTGAAGTTGAGGCAGCCGCAAGTGCGGCACGTCACGCCCCG
AGCGCCTCGCGCCATACTGCGCTGATACTGAACTATGGACTTGCGCGGTCCAGGCGATGACTCCACGATGATTGGAGGAAAAATGAAATATCATTCAGCC
AATGAAAAGAGACACGATCATCCAGCATGTAGCCATCGTGTCAAGGTACGTGTTGCAGTTGCACTTTTGCAGCAGCCCAAAATTAGAGCAGTTGAAGCAG
TTGGCTGCTCACTTTTAGCTGTGCATGACTTGTAGCGGGCAGGGCTGCTGGAGACGGAGGCAGACGCGTCATGCAGCCAGGCTACGCCCTGCTACGCGGT
GGCGAA