Description :
From Genome Similarity Track
Location :
contig_22:96447- 99053
Transcript NameFunction/comments
g5856.t1hypothetical protein
g5857.t1hypothetical protein

Sequence
2606 bases(100 bases per row)
CCTAATAGCTCTCAAATATGCTAAATACTCACTGTTATGCTTGGCGTGCTCTTCGTCCAGCTCGCTGTCGTCGATCATCGACCCAAGCTCACAATTCCAG
CAAACGTTCTCGTCGCCATTCTCTCTCGCGCACTTTCTGTGAAAATATTTCGTGCAGGTTGGACAGCGCACTAATCTGGACGGCAGTCCGGTTTCTTCGC
ACAGCTCGCACATGACCTTCTCTGGGCGTGTTCGCGTACGCTCACTACCGAGCGTCGGAACATACCACGTTCGATTTCCTGACACGGGTGTTGTCGGGAT
CGCCACAGGTAGACCTGTACCTTTCATTTGAGTGTTAGCAGGCAGGCCTTGCTTCAGCGTAGCTGTAGTTGCTACACTTGCTCGTGGAGTAGGCATCGGT
GACTCTGCGTCGCTATCCTCCGAGTCGCTCAGGTTTGTCAAGTCCACAACGTCTAGAAGTTTTAGCTGGGATCGGCTCACCTCTTCAGGGTCATCGTCTT
CCTCGGCATCTTCATCTCCACACTCACGCATAAACGCCAGAAATTCAGGACTGCAATATCCTAGGATAGGGGGCTCCACAGGAGTCATTTCAAGTGGCGC
GGCGTTGACCTTGACGAATAGAACTGCATCTCCATCAGCAGAGTCTGTAACGATTGGTGAGGGCTTTGTCCGCTGCTGAGCCTCATCGGTGCGCTTCATT
CCTTCAGGGTGCTTCTTTTTTGGCAATAGTACATTAGTAAAAGTACCCGCTTTCGTCATGTCAGCATTCCTGTTGGTGGGAGAAGATACCTTCGTTGCGG
CAGGCTTTACGATAGCGATACCTTCAGCCGAAGAGTACGGTACTGCTGCTGCATTTGTCGACGGGTTCGTAGTGACTGGTGCCAGCCTTGACGTCGCTGG
CGCGGGTACCGATAGAGATATTGATGGTACTCCTGATATCATGGCAGTTTGAGCTACCTCTGTCGGCACTGGTGAAGACGCTGGTGCGGGCGGTATTCCG
GTTTTTGCTACCGCTGCTACCTTTGTCTTCACTTGTGACGTTGTTGGCATAACTGCTGAGCTCCCTTGAGCAGGTTTGGAAAATGTCGGCGCTACTTGTA
CAGGCGTTGGCTTCAAAACTGCAGGTGGCAGCACTGCAACGGTCGGTGATACCAGATCCGGTTTAGATGACGGTCGAGGTGGGTTTGAACTTGGAAGCGG
TGCAGGCGGTGCCGAAGATTGTGCAGGTGTTGGTGCTGCCGGTGCTGCTACTACTGTCTTCAGCGATGGTACCGTTAGTACTCCGGGTGCTTTGATTGGG
TTCGTGGCAGCGTTTGCGGCTGGTTTTGCTTCAGAAATGGTTTTTTTAGTTGTGTCTGGAGGTGCTGTTGATGGCGCCTCCAGTCCCATTACTTCATTTG
CGCTAGGACCCGCAGATACCGTTGCTGCGGCTGGTCCCACAGACGTTGAACTTGTCGCCTTCGAAGACGCCGATGAATTCGCTTTCAGAGCCGGTGGTTG
GCTTCGTCGGGCCACCGCCAGGCCATCGAACACAGTAACGAAGTCCGACGCCTGGAACTCAACGGCGTCGAACGCTCGAGATTGGAAAAACGGGTCCTCC
TCCTCGCTTCTCGATACCACCTGCACTGCGCCCGTCTCTAGTTGCACTGCATTCTTCACTGCTGCGTCTGTTGGAGCAGTCGAAGCAGGGGCCTCGATAC
CTGTTGCTTCTCCTGAATCCGTCAGTTTAGCCTTCCCCTGCTCTTTTTTATCTGCAGGCGGTGGTCTCGGCTCCACTGACTTGGGATCTACCGGTTTCGC
TTGAGCAGGTCGAATCACCTGCATCGGTTGGGACACCACCGCCTTAACAGCATTTGCAGCTGCAGGGTGCGAGCGCGCGGCACCTCCATCTGCTGCGTGC
TTCCTCATCACGGCTACCTGCTCCATCGACGGGAAGTCGCTCTCTTTGAAGAATACCGTCGGGAACACCCGACTCTGGAATAACTCACGTTGCCCGCTGG
CATCCCCATGATTTTCTTTTTCTCTCCTGCTCGTGGCCTTCTGCACCACTACTTGGTCCTCCTCGTCGTCCGAGATGAGGTCGATCACGTCCGGCTGCGG
TCTCTTCTTTGAGGTATTTTTGGTCTCCTCGTACCTCCTCTTCTTGCCATTTGAGTGCACCGCATCCTCACGCAGCCGATTGGTTGAGGCACTCGTGTGG
CTTTTGGCCTGGTCGCTGCGCCTGGACACTGCAGTCTTGGAGCGGCACTTGTCGCACTCCTCGTGTTCCGAGCTGAAGTTGAGGCAGCCGCAAGTGCGGC
ACGTCACGCCCCGAGCGCCTCGCGCCATACTGCGCTGATACTGAACTATGGACTTGCGCGGTCCAGGCGATGACTCCACGATGATTGGAGGAAAAATGAA
ATATCATTCAGCCAATGAAAAGAGACACGATCATCCAGCATGTAGCCATCGTGTCAAGGTACGTGTTGCAGTTGCACTTTTGCAGCAGCCCAAAATTAGA
GCAGTTGAAGCAGTTGGCTGCTCACTTTTAGCTGTGCATGACTTGTAGCGGGCAGGGCTGCTGGAGACGGAGGCAGACGCGTCATGCAGCCAGGCTACGC
CCTGCT