Description :
From Genome Similarity Track
Location :
Scaffold_369:9640- 11634
Sequence
1994 bases(100 bases per row)
TTTCTTCGCGGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGTCGGCTTGTAGTGGCGGCCTGGGACAGGCTGCCTTCAGCAGACACTTCGCACGGT
CGTTATCAACGACATGAAGAAGCATGAGAGCGGGGCGAACTCTGAGAGCAATTGTATACTGCATAGTAAGGAGGCATATAGCAAAGAGAAACTACAGCGG
CTGCATTGAATACCAGAATTCATTTCACCTCCAAGCAAGTATTCTCAAGCAAGCAAAGGGTCGAAAGACACTACAAAATTGACTTTGGCCGTGGACAACG
ATCCAACACGGGCCATGAGCGGCCCCCAGCAGAAGCGCAGTCGGGCGAACACCTCAGGAGATGACGGTGACACGTCGCAGCCGACGACCAAGCTGTGGAC
AGCGTTGGAGCCATCTCCGATTGTCCGTTTCTCGCACGAGGCTCTCGTCAAGTGGCGGCGGGAGCGGGAGCTATACGAGGCGGCAGTGATTGCACGCTGC
CAGGAGTCGGGTGAGTCGCTGGCTACTGTCATGAGGCCGATGATCTCCACCATCCACCGCCGGTTGCTCAAGACATTTTGTGAGTTGGAATTGAAGACTT
CAGTGAGCGAGATGACGAACGACAGGCTGATCGCAGCAATTAACCAGATCTTGGCGACAATGATGAACGACCAGATCCCGAATGTTCATGCGATCATGAA
CCAGCACCTAAGGATGGACCTTCGCCAGAAGGATGTGAAGGCCAGGGTTTTGAACTATTTCGACAAGTTTGATGAACTCATCGAAGAATATGGCTTGAGT
GTGGCGCTAGACGGTAATGAAAAGCTGAAATGCCGTTTGCTGACTGAAAATCTGCGTCCCTCCGGCTTGAAGGAGCATGTTTTGCTGTACCAAGACCTAG
ATCCGACGGTGAAGCTCAGTGTACCGCGCTTGTTTGATGTGATCAAGGCGGAGGCACTCAAGAATCAACAATCCTTTGATCTCTTTCACTCGACAAGAGA
CAGAGGTTCAGCTAGAGCTACGAAAACGTCTCCTCGCAGCAACAATGGAGATCGCAGCAACCACAAATCGCAGAAAGGAGATCGATGGCGGTCATCTCGA
GAAGATCGTCGGGACGAGCGACCGACATTCAAGAAGCGCGATGCTGCACCTGCTCAGGGCTGTCTGCACTGCAAGGGCACTCATTGGGTCTGTG