Description :
From Genome Similarity Track
Location :
Scaffold_1455:964- 2029
Transcript NameFunction/comments
g16882.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
GTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGTTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATC
AAGATTCCACGTGACATGCTCATCGACAACCCGTCGGTGATCCAGATGATGACGAGAAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGAT
CGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGT
ATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGG
AGGTGCTCAACTCCCTGAACATCAGTGGTATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCT
GGGGTTGTGCAACGGAACGCGTCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGACAAGGCCAGCATGTGTTG
ATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGA
TCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTAC
GTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGAAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGG
GCGTAGGCAGTGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGC
GCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAG