Description :
From Genome Similarity Track
Location :
Scaffold_160:96394- 103055
Transcript NameFunction/comments
Physo_143982PREDICTED: similar to gag-pol polyprotein

Sequence
6661 bases(100 bases per row)
TTCCAGGACTTTAAGCATTTATGGGCTGGGCTCTCCACTGGTGTCAGTCTAGGAATCGATACTACCCTCGTCACATGTCGAAGCTGCAATAAGTACGTAA
ATGCATGTGGGTGGCGGTCCCAACTACACAGTAGTTCTACTAAACATCAAGGTCGGCACCGATTTTTTTTGAAGTGTAGGATTTTCTAAAAAGGAAGGAC
CAATCGACAATAGATTCTCAGTGTAATCACTATTACTACTACTTAAGCAATTAATGCACTATGGCGCTCCGGAGATTTCCCAAGGCTTCAGCTCGAGAGT
CATTCTTTGAACCCAAGACGAACTCGAGGGGGTTTCGCCGAGTGCGTTACTGCAGTATTAGTTGATAGCGAGGGTCTGAATTGTGACTTTAACCACTCAT
GCAACTGGTTGTTCCTTTCCGCGGATCTGGACCCCAACAAGCAAAAAAACAATCATGCGCACTGAAAATAATGAAGTCTTTCGTGCTAGTTGCATTTGTG
TTATGACTGTCGGCAAGTTGCCTCAAAAATTTGAGTTTGAAGTTTATTACAACCCCTTCATGTAGCTTGTTCTAGATTGCTAATCCAGTCGGGGTTAGGC
CCTCGTACATGTAGTATCTGTAGTTGCTACAATAAGTACTCCTCATACAAAGTCGCGCGCTGCACGAAGAAGCCCTGAAATTACAGACCTATATTTTTGT
AGAAGGTAAAGCCCAATTGCTCACTGCAGCGCATCTCCTGCGCCTGCTTCGCAGCCGCAGCATCTGCAAAGTTGACTTGGAACTTAGCAATACGTCAGTA
TCCTGGAGCATTACCCTCTACGATCAACTTCTGCTCACGGAACAATATGCTGTCGGCTACTATTCACTTCATGACTTCACCGCCTATTGCTTCTTGTTAA
TTCAATTTTTCGATACTACGTATTGAACATTTTTTTAATTAAAAAAGTAACGCAACCACTAGCTCATGCAGAGTTGGTTTCCGACCTATTGGGGTTGGTC
CCGCGAGTCGCGTGCCGCGATCCATCAGCTTTTACACAGAGCGGCATAGTTGTGATGGGAGCGGAGGTGGGTCTTGCCAAATGGACAGACCTTTGTCGGT
GTGCTTGGCGAGCGCAGTCGGCACGGCACGGTACGGCGTAGCTCAAACCGTACGTGATGATCGTGGACGTTTCGGGGGGGGGGGGGGGGGGGGGTTAGGC
TCGTAAGAGCGACAGGGATGACCGGTTGTGCTGCGACAGTAGTCATCGGCAACCACATAACGTTCTTGCTGGTGTGGACTAGCGGCCATCCATATGTCCA
GCGTTCGTTTTGCGCGTCTCCGAGTGCTCTTCGAAACTTTCGAATCGAAAGCCTCGGATTTCTTTCGAAAAACACAAGTCGCCGTTCGGACTTGGTTCCA
GTATCCATGCGGACCCCACGCGCCCCCTCGCCGCACTGGCGCTGCCAAAAAAACACACGGAGTTCCGTGCAAAAACACAACTTCACGGCAACCGAATGAT
GTATCCGCAACATCAAGATCGTACATAAGCGGAGGGGGGCGACGACACAGGCAACATTCAGGCAATTTACTAGGGCTTCGCGGGGGCTGAGATAGCAAAA
ATAAACTAGGCCGTCTGCGACTTAGCTGGGAACACTTATGAGAAGAAGTGCTGTATTCGGCAGTGGTAGATGTTGCAGTGTCAAGTTGAAGTGCTTGTCC
GTGTTTAGGTCTTTCGCAATTAAGATGAAGTCCAAAGCACTATATAGTAATTGATATACGGACAGCCCTGTCAGATTCGGCAGAGTGGGACCAATAGAGA
GTGGAAGGTTGTAAAATTCATGCAGGCTTCACATTGATTCAAATGTACTGAATTACTAAAACTTGAGCTTAGTGGAGGTTGCGTGCGGCGCATGTGCATG
CATCATTGAGCTTACTATCCCCGGATGCCTCCAACAATTCCTGAGAGTATCCTGCGTAACTCCGTCCCAAGCATGTGACGCCCACTCCACAGCATACTTT
TTCACCTTGTCGTCAGAAAGATGACTATATCGCTTCTTATATTCATCGCTTGATACTTGAAATGTTTCTGGTAGACCAGAAAGCGGGATGCACACGTGTC
CACACTGAGATCCCACCAGAAATTCGCAGCAAGAAGCACACGCAAAAATCCCACTCAATGACGGATCTGCAGCTGCCGCTGATTCTTGGCAGCGTGCGTA
TTCAGCTACGCCTGGGGGAGAATCCAATACTCTCATCAATCGTTCCCGCACTGATTCACTTTCACGAACGTGCTCGTCATTGAAAACGAATGCATCTGGA
TGACCTCCACAGCAGTAATGGTAAGCCAAAGCTAATCTCGGATCAGCCGTAAACTTCTGTCCACTCTCCATCAAAGCCATTTCGTCATCAGTTATGCTGT
TTTTCAGCAAGATAGAATATGCTAAGTCCTGTAGACGTTCATCTTGACCTCGTTGCCGCGACTCTTTTTCTGCAAATAAAACAACAACCAATCCATCAGA
GACTAGAATATTGCATCGAATCGAAACAATACCATGATACCTTTTCTTTTCTTCTACGTAGCCCGGGATGCTCGCACAGTATCTGCAGGCCGCTTCAACT
TGTTTTGCTTTGTAGCCATCTCTGCAGGCGCCATATCGCTAGAACCACGATCTGCTACACCCTCTCGGCTACTAGCGAGAGTCTTCTTGCGCTTCGCGCG
GTAATTGCGCGAGTAAAGAGCCTGCTTGCGCTTTTTATCTTGCGCCGCCACTCCAGCTGATGTTTCAGCGCTCTTCGTTTTAGTAGCTTCTTCCGTTGAT
ACGTTGCCGTCAATATCGCACTCGCGCCGCTCGCAGCTACTTGCCGTGATACGAGAGGAGCCCTGGTCGCTGCTACCCACGGTCGTTTCTGCCAAAGCAC
CACCCGAGCGCGTTGCAATCTTTATTCGCTTGTGTCTGGCACGGTAATCCCGCATGTAAAGGGGCCGCTTCTGCTTCTTTCTGTTAAGCAGCTCTTCAGC
AGCTGATTGCTTAGCGTTATCACGCTCGCGTTTCCTTTCCGACGCCACTACTTTGGCGGAATCAATACTGCTCGCAGTTGAAAGCGCTTCGAAAGTATTC
GACACTCGCCTGCCTTCGCCACGGACGGCGCAGCTAGCATCCTTAGACATTATTCCGCCTTGAGATCAATAGGCAAACTGTCAGTAGTCAATCAGATCTA
TTCAATTCAATCATATCTTGTCACTGCCGTTGAAGTCGTTGAAGTTGCTGGGTCAACATTCACTATTCGAACTGTGCCGCGAAGGTTGCGCCAAGTTACG
CTTACGCGTCCAAGTAATCCGTTGGGAGCTGTCCACTCCCTCATTCTTCGGGTGTTCCCAGTACAAAACAGATAAACGCACAGCGCACACGCCTTAGGCG
CGCCCCACTTGCGGCGCACCAGTCGCCCGCACTGTGCCTTTATATTATGAGCATCCACATCTACCATATAATCAGACCTTTAAGTACTTACGATAATATC
AATTTGCTTTCTTGCCTCCGCGCTGTTTTAATAACCAAATACAAACAAGTTATAAGCTGCAGCAACGCCCTCCCAAGCAGACGACTATTCTTACCTTCGT
GCTGTAAATGCACCCTGATGTTGCTGCGGCTTCAGGCGTGAGAACTGGAAATGATTCGAATGAAACTTGATGATGCGATTGATGCTTCTTCATTGATAGA
GACCGACTAGGTAATTATTCAGATTACCTATTAAGTCTATTTTCATAATATTTCAATATATGATGGATACTTAAACGCATGCGTTACACGCACGGCTTCA
TGCGACACCAAATAGGCAACCCGGAGCGTTGCTCCGGGAGGGTACACAGGTCGACAAATAGTTTCATGGACGACGATAGCGGATAATAATTGTAAATCCC
AAAGTTGTTTTGTTTTTAATCCTTAAAAGCACTACCAATCCAACTCTCTAGTTGATTCTAACGTGGGCATCTACTGCGCCTGCTTCGCAGCCGCAGCATC
TGCCCGAGAATGGGTAATTGAACAAATAGTTGCGCACATCGAAGTGTATCGATACGGAAATGATGTTTCAGCCAAACCTTTGTGAGGCTGGTAACCAGCA
AGCCCCGCTCTTGTTTATCGTGGCGGGTTCTCAGGAACCGAAAGTAACCAATTGAGGTTGCCTAGTCTGATGACGCCATCGGTGACATAACACCCTGGTC
AGCGTCCAATGGCTGCGTTGGCACCAGCAAAGAGAGAGCTATTTCATTAATTTTGCAGGTAAGGTATACTGTGCTCATTTTTTGTACTATGTTGTGTGCT
AACGATCAGACGAGAGAACTACAGTAGCGGAACGAAGGAGCGACGCATGGTGCGTTGATCTTGACCATTTGACTTGAGGATGTTAGCTAAGTGACAACAA
TGATCCTCAATTCAAAAACAAAGCAAACAAACAAACTTTTAACTTGAGGGCTTGGGGAATAAATTGCGGAATGATATATACGCTAATGGGCTGATTCCTT
GGAAATGGGTGCTTCAACGCCGGGAAAAAAGTCTTGTTCAAACGAACGATGCTCGTGTCACTGTCGAGTTGAGCTGATTGGTTTGGCGACAGACACGAGG
TTGAGCATCTTCGGCTAAGAGTGATTCAGTATTGAGCAAATTGACATGTAAAAAAATGCAGCCTGCACCTAGACAAGTCATGTTGGCCATCTTCAGTTAA
GGTTGGTCGATTATGGCGCAAATTGATACGCCTTCAGCGAAGCCATGACGCTTTCATAGTGTACTAGAGCGTCCGTAAGTGTTTGATGCCGGATTTGGTG
AATAATAAAACGACGATTAGTATCAACCTTTGGTAAATAATGCGCATAAATCTTAGCATTTATCGACGGGTACCCGATATCGCGGTCCTCCTCCGTTAGG
GTCGAGTACTTCGGCCAACAAAGAGTAGACGCGTAGCTTGCTGGTAAGACGCTAGAAGAAAGGAAGGCAATCTCGTAAAAATACAAAGGGTTTCTTGCTT
TCAACGAGGAGAATTCACGACTGAATCCTTCACCACATCATGCGCGGCCGACGGCTACCCCGCCGGCCCGCTTCCTTTCCTACTGCAACCACTTGGTGAC
GCCACACCTCCCGTGCACGAGCTTCCTGGCGTCCATGACACCCGTCCTTGGCGGCTGGAGACCGAACGTTCCGCGCCCAGCCCGCCATCTCGCGGCATCT
TTGCCTTGAAGAGTGGGATAACCACTCACACTTGATATGCTTGCCCGTCCTGCCCTTGCTCCTCTTGAATTTGCGCCTCTTCGTGCTCCAGCGCGCCTTC
GAGCATCGTCAGGAAATCTGTCAGTCGAGGTCTCAACCGTGACCCGTGACAACTCTCCCCGACTTCAGGCTGCCGTCCTCGGCCAGCCTCGCCCTTGTCC
TCACTCGTCGCAGTCGCGGGGCACGTCGGACCTTGCCCGTCCGCCTCGTCGACGACCACGGGCACCTCCGGCCCGTTCGTCACCGGCTTCGACGGTACCA
CCGCCGATCGACGACGTACGCCACGCAGCTTGTTGAGACTTGCCTTTTCTGCGCGCTCCTTCGCGTCCTTGCGCTCACACAGAGCGTCCAACCCCGACCT
TGCGACCTTCTTCGGCGCCTTCGTCGGCATGCGCCCGTGGCAGCGTCGTACGAGATGGCTGTAAAGCCCACAAAGCAGCAGCACGCCGTTCTTCATCACG
AAGTTCGGTGACATCCGTAGAATTAGCACGCGTAGCTGCACGTCCATCGAGAGAGCTCCGCTCTCGAGGAACGCTTTCATCGCCACCATCCACGGAGTCC
ACCCTTGCTCCTCGACGAACTTCTCGCTGTCGAGCCCGAACGAGTCCACGGCGGAGGGAGAGTCCGCCTCCGTCCTGCCGCCCTCGTCCTCTTCCTGCTC
CTCCTGCGTGAGACGCGGACCCTCGCCTCGAGCAGCCTCTTCGAAGTCACGCGCGACCTCCGTTCTTCTCTCGTCGTTGCCCCGCTCTCTGGCTGGGACG
ATATCTCGCTCGTCCGCTCTCGGAGCCAGGTCCGGCTCGACCCGCTCGCTCAGGCGCTCATCGCCTTCATGCTGCTCTTCGATTTCGACGGCCGTACCCT
CGTCGTCAGTCGCTCCAGTCATCCACACGTCCTCCAGACGCAGCGGTCGTCGCACTTCTCCACGGCCCTCATCTCGGCCCGAACGCTCCCCGACTTCGTC
GGCGCCACGCCCTTCGGGCGTCGCCGCAGGGATCCATACGTCTTCAAGCCGCAAAGGTCGTAGCCGGCCCGGACCGTCACCTTCGAGACGTCCGGGCGGG
TTGAGCAGGTCGTTCATGGTCACCGCGCCAATAACGGGCCGCTGTCTAAGCCTCGACAGGCCGTCCGCGTGACCCATGAGCGACCCTGCACGATGATGAA
TCTTGAAGCGTAGCTGGGACAACTCCATAGCCCAGCGCGCCAACTTCGCGTTCGTCGTCCGCGTATTCTCACCGAAGATCCAGGTCAGGGCCTGGTGGTC
CGTATACAGGTCGAACTCCGCGTGGTCGAGATAACACCGGAACTTCCGCGTGGCCCAGACCACGCCCCAGCACTCGATCTACGTTGTACCGTCCGATCCA
GTTCCGCTGGGACCCCACCAGCATCTTGCTCGCGTAGGCGATGGCCCGGTCTCGGCCGTCC