Description :
From Genome Similarity Track
Location :
scaffold_45:96390- 98884
Transcript NameFunction/comments
Plaha_PHALS_10572hypothetical protein

Sequence
2494 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAAAACTGCCCCGACGTCGTAGACGTTTATTATTTAAAGGATCACAACGCTTCACGTCATCGTGCACCcctcgcttcttggca
gtagcccgggacgccagagggccatgagccgagctcaaactatggccctgagctgctgtggccgTAGACTCATCCGTGAGGTACCACGAGCTAGCGGGAG
CGCGATGGGTGATTCGATGTCTTGCAGGGCTACCTTTCTATCATTTCAGTCATTATGAGTACTATGTTGTTTAACTtatgcagcggtttcgccagagGCG
AGCACGACAGGAATAGTCGGCATTGCGCGTTCAGGAGCGCTTCTTttatgagctcgaagtcgagcgcggtggcgatccattgggatttcttggggtacca
agaagcgagttcGAAGACCTtcccgctggtcaagctcaggttgtgtagtggccggggctccgactacgtagacgcctaacgatcaagtgatcgcgtcttt
tgcttcagtagtaCTTTCGCCGACCGGAAACCGTATTATACTCGAGGATTTTgaaccgaacgtggatacgagcgcatcaGATCCACCCTATGAGTAGCCT
TCAACTGTTGCTCCTATGCATTGTGGAGGCGATTGATAACAATACCACTCCCCCCGGAAGTCAAGAAGTCGGGGAACGggcacggtgtccgcaaggtttg
agcaggcctcacgtcgcgccgttggcgctcCTCACCCTCCTCGTTTTCTCTTGCTAGGGAAGGAGTacccgactcgtagtcgactttctccgaatcctcg
acgaggaaatccgtcccCCGAGTCGGGtgcggtgtgtggcgcttgGTTGCTGAGGGCTAGGGATATGCTTTCCGTCAAGCCGCATACGTAGTGTCCGGGG
ATGCACCACGTGCAGAAGAAAAATAAGACTCTACCCGCAGGCGCcttcggaaccagctaggctgggtgttgtTCTCcttgtcatagacacaaggctcatt
gagcggagaatttTCAAGAATGTTCTAAaggacgtaacggtgtctcagacacgcgagcctcgtatgaggcgactgttaaatgtgaactgtGGGTAACACA
TtttatgggggagagtgtaacggggttatacgTACTTaagtatgaaagggcgggttaCAAAAGACAAAATGACTAAcctaggtgtggattacacaagttg
gtgtaaacacacaatggtgtggacaagaagccactacgtggcagaacTGCCAGTAGTGCTCTATATTTTTAAgtttaggaaaacctaaaaaTTTTggtat
tggcggctctgccgcagctaTAACTATAAAATACGATTTAATCTTAAACAGAAGAATTAATCCGCCTTGCTAAAAGTTTATAAATACTCTGTACAGAAGA
ATTTATTTGCCGTGGTAaaagttttaagtactcttggtagcggattgcgatccgctacactcgtactggtccttgtaaagaacgcaaGGTCAGGGACCTT
AGCCTAGCTTCTTCTGAGCAAAGAGATACGACAACCCGGCTGCACACAAGCTGTCTACATAAAAGTGGGATTGCCTTGCTCATTGCGTAATATAGGCGTG
GATGACTCCACGTAATTGTTACAAATGAGTTTTGGAATCGAAAAGCAATGGAATATCTTCGATCATCCCATCGCGCACCCTTTGAAGTCTACCGTACTCC
CGCTCAGGGGTGCACAATCAGATTGGTGCTTGGGAACAAAAGGGAGCTCGGATATCGTGACGGTGCTTCGTTTTCGAAAGTGCATCCCGCTTAT