Description :
From Genome Similarity Track
Location :
Scaffold_285:9638- 10847
Transcript NameFunction/comments
Phyta_totarag6669hypothetical protein
Phyta_totarag6670hypothetical protein

Sequence
1209 bases(100 bases per row)
GTGGTCCAGATGTAgttgacgaggatgacgaagacagAAGCCACCTCGAGGTTGGGGGCCAAGTATGCCAACAATTGCCCGAAGTATGCTTGCAGGACCA
CGAGGCCAGTCAAGTTCACCCAGTACGACAAGAACTGCACCCCGCCCGTGAATCCTATCATGGGATAGTAGATGATCATGAACAGCAGAGATTCGACAAA
ACAGTACGGGATCTCGACCAGTGTGGCTCCGACGAAGTACCAGAACGCATTGTACGTTTGAGCCGAACGTTCACGGTAAAATGACGCTCGCTCCTGCATC
GAAATCGGCACCACACTGCTGAACACGATGAATGTCATGTACGACTGCGTCATAAACACCATGCCAAGACCCGAGTTGATCCCCTGGTACGATGAATACT
CCGCACTCACGTAGGCGACCCCAAATACTAACCCCAACATGACCGAAATGAGAAATCGGGTCAGGTTGTAGGCAGCTGTCCTCCAGTATATGTCGAAAAA
GCGCTTGATCAAAAACTTTGCCTGGATCAAATTTCCAGCTGCACGCTTCTTGTCGAATACCAACGCAGGAACCGAAGGTGACGGGCGACCAATTCCCTCA
TGATCCAGGTTCGCTACTAGCTGTTGGGCTTGGACACTAGACTTGAACAGCTCCACGAAATCGGTTTTGTCCCCGCTGTCGTTGCCCACATCAGCACCGA
TCATCTCCAACATCCACGTAGCTGGGTTGTAATCTTTCTCTAACTTAGCCACACCGTCAATCGATTCGAAGTAGTTGATTAAACTCGACGCCTACTCGCC
CAGATCACCGAAGAAGACCGTCTCACCACCACGCTTCAGTAACAAGAGACTGTCGAACACGCCAAAAACCACCGCTGACGGCTGGTGAATCGTGCACACG
ACGGTGCGACCCGTGTCCGCCACCTTGCGCACACCGTCCATGATGACTTTGGCTGAGCGCGCATCCAAACCACTCGTCGGTTCATCGAGGAACAGCATGC
TGGGCTGCGCTGCCAACTCCACACCGATCGTCAGTCGCTTCATTTGTTccgtggagctgccgcgGATGATCTGGTCTGCGATCGggtgctggtccagcaa
ctcaaggCATTCGTTCACGGAGTCATACTTCTGGCTGTTAGATACCTCAGCATCCTGACGCAGAAACGCACTAAACGTAAGGGCCTCGCGGAACGTGGAC
GCGTCCGAG