Description :
From Genome Similarity Track
Location :
scaffold_82:9636- 10657
Sequence
1021 bases(100 bases per row)
TGGAGATGGATCCGTAGCTAACCAGCCTACAAAACGAAATAAAGCATGGTGGGAGCCAAAAGTGACACAAGGCCAGATAACATCCCACATAGCGCGCTGG
TTGATCCGTGATGATAAGTTTTTAATTTAATGCGACTGAACTGGTATCATAATTGACAGATTGCTATGTCAAGGCTTTCCGCATAACATGATCACAACCA
CAGCTTTTCGAGAGCTAGTTGTTGCTCTGACAGGTGATCCAGATGCTTCTATTTGTCAAGACAGACCTACAACGACATAATTGATAATCATTATGATTTA
TTCGAGACGTACTTTGCAAAACTGTGTGCAGATGAACACAAGGAGTTGTACGGAACTCCCTTTATGACCCTCGAGCATGATATATGGACGAACAATGGCA
ACAGCCACCATTGTCGACGTGTCAACAGGGTTTATAGATTGAATGTGATGTCCTCGACACATTGCACTACTAGATCATACCAAGAATGATGTCCACGACT
CGGAAGACGTCGCGTCGTTGCTGAACGACGAGCTGAAAGCGTGCTGCAATCCAGACGTGAGTGGCGTGGTCGGATTTTCACTTTCAGACACCGTTTCCGT
AGCGCGTAAAGTATCGAGACAGTTTGACACAACTCTACAAACCGGTTGTGCAACACATACGCTCAACCTCTGCATTGGATACGGTATTGGGTTAAAGAAG
AATACAAGAACACAATATCAAATGGACCCCAAGCCAAAGGAAATTACGAAAAAGAGAATTATCGTGACACAAGGAGGGGCGTTACATGAAGGGAGTGCAG
TTATTCGCAAGCTTCATGCTCTCAACAATTTTTGCATCGAGCAAATCACCGTCTCGAATTGCCATTTTGCTGAAATACAAAAGTTCCGCAAACTCCCAAC
CCTGGCAGCGATCGTTGACGTTGATTTGCGTGTGGCGTCTACAATCAGGTTGATTGGGTGCTCTATTATTAATTATCCGGCGTTTAGGGTGTTCTGTCAA
GATGCCAACAAAAAGAAGAAT