Description :
From Genome Similarity Track
Location :
Scaffold_353:9634- 10904
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_353-snap-gene-0.12Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1270 bases(100 bases per row)
CGCGACGCCATTCGCCGACACTACTTTCTCTCTCGCTCCTTCGTCGTGGACGTCGCGGCGCTGCTGCCGCTGTTCGCGATCAACACGTTCCTCCCGGCGG
GCCAACGTGTCGAGGTGCTTAACCTCAACAAGATGCTGCGAATGTTCAAGTTCACTCGCCAGTTCCAGTCGCTCTCGACGCGCTTCGTCAAACTCATGGT
GGAGATCCGGCTGCTCAAGCTGGCCTTCTACACGTTCGTGGCCACGCACATCCTGGGCTGTATCTGGTTCGACTTTGCCGCCAACAACTCGGGCTTCCAC
TCGGCGCTGCACGTGTCCGCAAGCAGTCACGAGACGGCAACCATCGACTCGAGCGAGTCCAGCGGTTCGAGCGAGTCGTCCTCGACACTCCTGAGCTTCG
GCAGCAACGAGTGGCTGCCACCCGAGGAGCTCGAACACGCGTCGCCGCTGCTGCAGTACCTGCGGTCGCTCTTCTGGGCGTTCGGGCTCATGTCGGCGTC
CAACACGGGTGAGCTGCCCAAGACGGTCTCGCAGTCCATCTTCAGCGTCATCACCATGACGGTCGGCTTCTTCCTCTTCGCCTACGTCGTGGGCAACTTC
TCGGACATCATCGAGCTGCAGGACTCGGAGAATCGGCACTTTGTGGCGCAAGTGAGCTCGCTGCGCAAGCTGCTGAGGCACTTCAAGTTGCCCGTGGGGG
TCGAGGACAAGTTCAAAAAGTACTTTCTCTTCAAGCGCTTCCACTCCATCACGCAGGAGCACGTGCTCGAGCGCGTGTTGCCGCCGTCGCTGCTCGTCGA
CATCCGCCTCTTTCAGCTGCAGCCCATGATCGTCAAGGTGGCCTTCCTGGCCGGCATGGACGAAGCCGTGACGCGCATGCTCGTGTCGCTCTTCACGCAG
GTGCTCTTTGTCAAGGACGAGTACGTGTGTCGCTTCGGGGAGGAGGGTCGTGAGATGTTTTTCATCTTCACGGGCGTGCTTGACATCTACATCCCGGTGC
GCTCAGACGCCGTCACGGTCGCCGCCGCGGCGCCAGACACGAGCGCGCGAGTCGCGATGGACGGCCCGAGCCCCGAGGTGCTGCGCAAGGTGAACGAGAT
CACGGCTGGCAGCTACTTTGGCGAGGCAGCTCTGTTCACCAACACGCCGCGCAACGCGTTTGTCAAGGCCAGCACGTCCTGCATCCTGTACCAACTGTCG
CGCCACTCGCTCGAGCTGGTGTTCGAGCGCTACCCCGACTGGAAACAGAAGGTGCTGCGCATCGTCAAGA