Description :
From Genome Similarity Track
Location :
Scaffold_66:9632- 10708
Transcript NameFunction/comments
Sapdi_VS20SDRG_13994hypothetical protein

Sequence
1076 bases(100 bases per row)
ACACGAGCCACTTGAGCCATTCGCCGCCCGCGACCAAACCCATGTTGGCGAGTGCCGTGTTGGCGTTGTGGATAAGGCCGTTCGGGCCGTAGAGCGGCAG
CACGCCCATCGAGAGGATCGAGAGCACAATGTTGAAGATCGACGAGAACACCCACATGTTGCGCATCGTCTTGCGAAAGATGCCGGGTTGCTGGTGCTCG
ACAAAGTTGGCCGACGTCTCGTAGCCAGTCACACCGAGCATCGACGCCGCAAAGCCAAAAAAGAGTGCCGTCCCGACGGTGCCGTCAACGACCGAGCCGA
CAAAGTCGACCTGCGGGTACGGCGCGTTCCAATTCTCCGTCAGAATCGTTGGGTGTTGGATCTAGAGCAATCCCAATGCGAACTGATAGACGATAGAAGC
CTTAGAATGTAGGTTCGTACCGTGTAGACCAAGCTCGCGACTGCAAGGATTGAAAGCGTAATGATGTGGAAGACAAAGATGACGAGCGCAACGACCGCCG
ACTCGGAGAGACCGAGGAAGAAAAGTAGGGCAAACGCGCCGAGAAGGCCCACGGTGGTGCTAACGACCGGCAGCTCGGGCACGACAAACTGAAGGTAGTA
GCAAGCGGATGTCCCTGAAACGACGGCCGTCGCCGTGTACGAAAGGATGCTCAGCACGGCCGCCACCGACGCAAACCGCTTGGACGTCGTGTTCAAAAGG
CAGTTGTACGAACCACCGTTGATCGGGATGGCCGTCACGACCTCTTCGTAGATGAAGCGGTACATGTAGAGCACAAAGGACACCATGACCATGCAAACTG
GCGCGAGGTTCCCGGCCTTCAACGCAACGAGACCGGCCGAGTAGAGGACACTGGACATGATGTCGTTGCCACAGAGCGCTGTCGACGGCCACTCGCTCAA
GAGGTGCTTGGCGCGTGCGTTGAGCTTGGCGCGAATGTCGACGAGGTCGTCGAGCGGGGGTCGAATCGTGTCTGCCTTGCGGTTGTACATGGAGGACGCG
GTCGTGCCAAAGGATAAGGCTTCTGGCGGACTCTGCTGGTGTTGCAACTGGTCGAGACCCGTAAAGAGTGTGAGCT