Description :
From Genome Similarity Track
Location :
contig_22:96313- 98919
Transcript NameFunction/comments
g4713.t1hypothetical protein
g4714.t1hypothetical protein

Sequence
2606 bases(100 bases per row)
AGCTCTCAAATATGCTAAATACTCACTGTTATGCTTGGCGTGCTCTTCGTCCAGCTCGCTGTCGTCGATCATCGACCCAAGCTCACAATTCCAGCAAACG
TTCTCGTCGCCATTCTCTCTCGCGCACTTTCTGTGAAAATATTTCGTGCAGGTTGGACAGCGCACTAATCTGGACGGCAGCCCGGTTTCTTCGCACAGCT
CGCACATGACCTTCTCTGGGCGTGTTCGCGTACGCTCACTACCGAGCGTCGGAACATACCACGTTCGATTTCCTGACACGGGTGTTGTCGGGATCGCCAC
AGGTAGACCTGTACCTTTCATTTGAGTGTTAGCAGGCAGGCCATGCTTCAGCGTAGCTGTAGTTGCTACACTTGCTCGTGGAGTAGGCATCGGTGACTCT
GCGTCGCTATCCTCCGAGTCGCTCAGGTTTGTCAAGTCCACAACGTCTAGAAGTTTTAGCTGGGATCGGCTCACCTCTTCAGGGTCATCGTCTTCCTCGG
CATCTTCATCTCCACACTCACGCATAAACGCCAGAAATTCAGGACTGCAATATCCTAGGATAGGGGGCTCCACAGGAGTCATTTCAAGTGGCGCGGCGTT
GACCTTGACGAATAGAACTGCATCTCCATCAGCAGAGTCTGTAACGATTGGTGAGGGCTTTGTCCGCTGCTGAGCCTCATCGGTGCGCTTCATTCCTTCA
GGGTGCTTCTTTTTTGGCAATAGTACATTAGTAAAAGTACCCGCTTTCGTCATGTCAGCATTCCTGTTGGTGGGAGAAGATACCTTCGTTGCGGCAGGCT
TTACGATAGCGATACCTTCAGCCGAAGAGTACGGTACTGCTGCTGCATTTGTCGACGGGTTCGTAGTGACTGGTGCCAGCCTTGACGTCGCTGGCGCGGG
TACCGATAGAGATATTGATGGTACTCCTGATATCATGGCAGTTTGAGCTACCTCTGTCGGCACTGGTGAAGACGCTGGTGCGGGCGGTATTCCGGTTTTT
GCTACCGCTGCTACCTTTGTCTTCACTTGTGACGTTGTTGGCATAACTGCTGAGCTCCCTTGAGCAGGTTTGGAAAATGTCGGCGCTACTTGTACAGGCG
TTGGCTTCAAAACTGCAGGTGGCAGCACTGCAACGGTCGGTGATACCAGATCCGGTTTAGATGACGGTCGAGGTGGGTTTGAACTTGGAAGCGGTGCAGG
CGGTGCCGAAGATTGTGCAGGTGTTGGTGCTGCCGGTGCTGCTACTACTGTCTTCAGCGATGGTACCGTTAGTACTCCGGGTGCTTTGATTGGGTTCGTG
GCAGCGTTTGCGGCTGGTTTTGCTTCAGAAATGGTTTTTTTAGTTGTGTCTGGAGGTGCTGTTGATGGCGCCTCCAGTCCCATTACTTCATTTGCGCTAG
GACCCGCAGATACCGTTGCTGCGGCTGGTCCCACAGACGTTGAACTTGTCGCCTTCGAAGACGCCGATGAATTCGCTTTCAGAGCCGGTGGTTGGCTTCG
TCGGGCCACCGCCAGGCCATCGAACACAGTAACGAAGTCCGACGCCTGGAACTCAACGGCGTCGAACGCTCGAGATTGGAAAAACGGGTCCTCCTCCTCG
CTTCTCGATACCACCTGCACTGCGCCCGTCTCTAGTTGCACTGCATTCTTCACTGCTGCGTCTGTTGGAGCAGTCGAAGCAGGGGCCTCGATACCTGTTG
CTTCTCCTGAATCCGTCAGTTTAGCCTTCCCCTGCTCTTTTTTATCTGCAGGCGGTGGTCTCGGCTCCACTGACTTGGGATCTACCGGTTTCGCTTGAGC
AGGTCGAATCACCTGCATCGGTTGGGACACCACCGCCTTAACAGCATTTGCAGCTGCAGGGTGCGAGCGCGCGGCACCTCCATCTGCTGCGTGCTTCCTC
ATCACGGCTACCTGCTCCATCGACGGGAAGTCGCTCTCTTTGAAGAATACCGTCGGGAACACCCGACTCTGGAATAACTCACGTTGCCCGCTGGCATCCC
CATGATTTTCTTTTTCTCTCCTGCTCGTGGCCTTCTGCACCACTACTTGGTCCTCCTCGTCGTCCGAGATGAGGTCGATCACGTCCGGCTGCGGTCTCTT
CTTTGAGGTATTTTTGGTCTCCTCGTACCTCCTCTTCTTGCCATTTGAGTGCACCGCATCCTCACGCAGCCGATTGGTTGAGGCACTCGTGTGGCTTTTG
GCCTGGTCGCTGCGCCTGGACACTGCAGTCTTGGAGCGGCACTTGTCGCACTCCTCGTGTTCCGAGCTGAAGTTGAGGCAGCCGCAAGTGCGGCACGTCA
CGCCCCGAGCGCCTCGCGCCATACTGCGCTGATACTGAACTATGGACTTGCGCGGTCCAGGCGATGACTCCACGATGATTGGAGGAAAAATGAAATATCA
TTCAGCCAATGAAAAGAGACACGATCATCCAGCATGTAGCCATCGTGTCAAGGTACGTGTTGCAGTTGCACTTTTGCAGCAGCCCAAAATTAGAGCAGTT
GAAGCAGTTGGCTGCTCACTTTTAGCTGTGCATGACTTGTAGCGGGCAGGGCTGCTGGAGACGGAGGCAGACGCGTCATGCAGCCAGGCTACGCCCTGCT
ACGCGG