Description :
From Genome Similarity Track
Location :
Scaffold_18:9631- 14621
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.3GTPase
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.4Mitogen activated protein kinase 7
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.2060S ribosomal protein L6

Sequence
4990 bases(100 bases per row)
GACGAGGAAGACGATGGCGACGATGAAGATCACTTTGAAGAGGACTGGGGCGACGACGACGACGACGACGACGACATCTTTGACAGCTGGGATGACTTCG
ACGAAGGAGTAGAAGGCATCGGACAGCAGTTCGCCACGGAAGGCAGCGGCTCGAGTCGGAAAATGGAGGAGCACGTCAAGCAGAAAGTCGGCGTCCAACG
CGCCAAGCACGCCAAGCGCCGGTTCGTCGACCGGATCCGCATCAAAGCGAGCGGGGGCCACGGCGGGAACGGATGCAGCAGCTTCTTCAGTGCGTACAAG
TCCATTTGCGGCGATCTGGATCTGGATGGTTGGATGGAGTCGAGGGTTCTAACTGTCGTGTTGGTATCGTAGGTGAGACTGCGCTGCGTCGACGTCCCAA
CGGCGGCCACGGCGGTGCGGGCGGCAATGTGATTATCCAAGCGGACGACCGAATGCAGAACCTCGCGACTTCCACCCATCATTTCAAGGGAGGTTCAGGC
ACCAACGGCATGCGTACGTTGTCTATTGTTCATTGATGTTGCTGTCTCAGCACCTACAGTCTACTTATCGTTGCCATACATTTTTCAACTTGCAGCGAAT
GATGCGGCTGGTCGGCGTGGCAAGCACTGCTTTATGAAAGTGCCGTGCGGGACGCTAGTGAAGCGAGTGCACCGGGTAAGGCTGTCGAGCGTTGTGAGAT
GTTGCTGGGTTTATCTCGCTGACCAGTCCTGTCTGCATTGGTATGTGATCTGGTATGGAACAGTTTGAACGCGAGCTCGAGTCAGGAGAGTACGAGATCG
TGGACCGTATGGAGACCGTGTGCGATCTGGACAAGCCTGGCGCGACCTTCCTGGCTGCCACAGGAGGCAAACCAGGTCTCGGCAACCGCATTCTGGCAGG
CAAGACAACCAACTTTGGACGCCTACGCAAGCAGATGCCCGAAACGAAAACAACCGGCCAGCCTGGGACATCCCAGTACTATGAGCTGGAACTCAAGACG
ATCGCGGATGTTGGTCTTGTCGGGTACCCGAATGCCGGCAAATCGACTCTGCTGAGCACACTGAGTCGGGCGACGCCAGAGATTGCTCCATACCCCTTTA
CGACGCTGCATCCGTTTGTCGGGATTGTCGAGTTCCCGGACACATATCGGTTGAGCGTGGCTGATATCCCCGGACTGATCGAAGGAGCGCACCGTAATGT
TGGTCTGGGCCATGATTTCTTGCGGCACATCGAGCGCACAAAAGTACGGAACCTGGCTGATATCTGAGTTCGAACCACTAAGCTCACGGAGAGTGTTGCC
ATTGTAGATCTTGCTCTACGTGCTTGATACTGCCGGCTCTGAAGGGCGAGATCCGCTGGAAGACTTTTCTCATCTGCAGAAGGAGCTCGAATTGTACGCG
CCGAACATCACGACTCGACCCTCGCTCATCGTCGCGAACAAAATGGACGAACAAGGTATGTCAGTTGTCATTCGGGTCGTATCATCTGGATGAATGCGTG
ACATTATATGCTGAAACTTCAGGCGCCGAGAAGAATCTCCTCAACTTGAGAAAGGCTACCGACTTGGCGATTCTGCCAGTGAGGTACGACCAAACCTCCG
AGTCGTTATTCGCATCGTAATGATTGAATACCTGACTGTGTACTATGTCTCACTCACAGCGCTCTTCACAAGGTCGACATCGATTCAGTCGCGAGAACGC
TCCGTTGGATGATGGAGAACTATTCAAAGCTGACCAAGTGAGTGTAGGCCACACTGGTGTCAACAGAGTATCGGATTATTCTCCGTTCTGCGGTCTTGTT
AGATCACATGCAGATTGTGGTCGCTCGAACCCACTCTGTTCGTTATAGATCGCACGATAGGTACCCCCAATTTAGCCAACGAGTCGATTTGTCAGGTCGG
TTTTGTGTTGAGTGTGGATTGCGAGTTTCGCTGGATGTCTGTCTGAGGAGCGCGTAAGGAAGACTTTGACGTTGCCGTGTCCATGAACCGCTACGAGCTG
CTCGATCGTTTGGGCGATGGCACATTCGGGGAGGTGACCAAGGCGAGAAACCTCAAGACCAACGAGGTTGTGGCGATCAAAAAGCTGAAGGCGGTCTTCC
CGACGTGGGAACAGTGTCTGCAGCTGCGCGAGCTCAAGTCGCTTCGAGCGCTCCGCCATGACAACATCGTCCAGCTCAAGGAGGTCATTCGCGACAAGGA
GGAGCTCTACTACGTCTTCGAGTACATGGAGTCGTCGTTGTTCAAGGTCATGCGCGACCTCAATCACGAATCGTCCACGACGAGTCAAGCTGATGATTCC
AAACCGAACGCTGGAGGCTATGCAGCGTCGGGGAGTCGGACAGTTTGGCTCTCAGAGGCACAGATCCGATCAGCCATGTACCAGCTCTTCTGCGGCTTGG
CGCATATGCACAAGCACGGGTTCTTCCACCGAGATATCAAGCCCGAGAACCTCCTGTGCCAGGACGATGTCCTCAAAATCGCGGATTTCGGACAAGCGCG
CGAAATCAGGTCGTTGCCGCCGTTCACAGACTACGTGTCCACCCGCTGGTACCGGAGTCCGGAGCTGCTACTGCGTTCAACAACGTACAATAGCCCTATC
GACTTGTGGGCGTGTGGCTGCATCATGGTGGAGCTCTATCTGCAGTCGCCACTGTTTCCAGGAACGTCCGAGGCCGACCAGCTCTGCCGCATAGCCAAAG
TGCTCGGTGCACCGACCAAGGACACTTGGATCGAAAGCATCGCTAAGACCAACCACATGTCGTTCAAGTTCCCAAAGAGCGTGGCTGTGCCTTGGAAGAA
CATTCTCCCCGCCTCATGCAGCAAAGCAGCAGTACAGCTCGTGCAGGACCTGCTCCAGTACGATCCCGGTAAGCGGTTGACGGCGACGCAGGCACTGCAG
CACCGCTTCTTCGACCAACCTGTTCCTCGGCCGGTGCTGACAGCAAGGAATTGCAGCACGCCACGCGATGGATCGTCACTTCGCTCAGAACCCAAGACGA
ATGCTAGTGTTCACCTGACCTTGAAGGAAATCTCCACTTCCGAGACGTCCACTCGACGAACAAATCGCCGAGATAGTGACGTTGGCGAGATGGGCGGTGG
CAGCGAGTCGAAGTTTCTATCATCGGCGGTAAACACCACATCCGCGAAGGACTGGAAAGACGCTAGATCTACCTCGAGACGAAACTGGCAAGACTGTCGC
GCCGAGGAGAAGAGCAGCCCAATGGATCGCGTGCAGAGTAACTTTACCAACAATGTGAAGGTGACAACATCCGCGATGTCGACATCACGCTCGTCAGGCA
AGTCGGGAGCGATTGGGCCAGAGGAACTCGACAGTGCGGACAACGACAAACAATTCACTTGTGCAAGGCACCACCATCCCAGTCGCGACAACTCGCTCCA
AGATCTGTTGGACGAGTTCCTTGACTAGCTAAAACTTCATTTAGCAGCACACTGCCATTACTCAAGTTTGTTCAGTCCATCTCGAGGCAAAACAGGGGAC
AAGAATGCTCGTTCGGATAATTCATCAGGTATTTATTCGCTCCGAGTTACCCCTGTGTCGCCAGGGTTCTTGCACACCGATGAAGCGCGCTTAGAACTGC
ATGGCGTGGACGCGGTCGTTCTTGGTGAGCGAGAACTTGGCGTTCAGGTAGGCCTTCAGGAACGGCTGCGCGTCGATCTTCTTGACAAGAGCGGCGTCAA
CGGCCTTCTGGTCCTTCTTGCGCTGCTCCGGGATGACCGGGGCCTGGAAACAAACACACACACATCGTGCCATCGCAACACGTCAGCACCATGCGGCTCG
GGAGCTTTTGCTTTTGTCACGGCAGCGATCCCAAGCGCTGAAAGGCGAGCAAGCATCGCCAGTCGGCAGTCATCGACCCGAGTCAAAAAGTACTCTCAAC
CGGGGAGACATTCGACGGCGACACCCACATCAAGGTGGGTCTCTCTGGAGCTGTCCATCAGGTTGAACAAGCTCCAGATCGAACCCACCAGTGACAAGAG
GACGCTTCCATGACCAGGCAAGACGATCAAAAGCAGAGCGGCAACGCACCTCGGCCGACTGGGCGAAGAACTTGTCCTCCTTCGACTTCTTCGAGGCAAC
CTTCTCCTTGGCGAAGTAGGCGTCGTCGATCTCCGGGAGAGCGACACCCTCGAGGTCAACCTTGGTCGACGTGGCGATCACGTACGACTGGTTGACGCGG
CGGAGCGGAACACCGTTCACCTTGTACGGGCCTGGGATCAAGCAGACACAACGTCAGTCATACAGTTCGACATCATGACTAGATAGACCACTGGAGCGGG
TCGAGGATTCCTCAGCTCTCATAATCTGAGCAATCTTCGGCCACCACGCGCTCTCGTCCGCTCCAACCAAGGCCCAACGCCAGCAACCATCACCTCACAT
AAGCAAGAACGACAATCACCAACTGAGGTGTCAAGAAGACATCCAGCAACCGCCACCACCAAAGACCTCCCAACCCGAAGGCGACAGACCCAAGGCAACG
ACAGACACCGAACACCCTCCATCTTCCACCCCTGGAACCCAAGCCGAAACATGACGAGCGCACGCGTGGCACCCTCTTGAGTGTCAAGTTGCATCTTTGG
AATCCCCTCCCCGCTCATGACAAGTCGCCTTGGCAAAAAGCAACGCACCGGTGACGAGCAGCAGACCCGAGGCGAGCTGCTTGATGAACACAACGCGCTT
GCCGCGGAAGCGGCCCGACAGAAGGATGAGCACCGAGCCGGGGGTGATCGACTTGCGAAGCTTAGCCGTCTTGACGCTGTTGCGCGCCGTCTTGGCCGAA
GGCAGCTTCTTCGGGATGTAGTCGGCCGGGTACCACTTCTTGGTCGAGATCTGCTTCTTGGCCGTCACCTTCTTCTCGCCGCCCTTCTTGGCGAACTTGG
CGCGGCCGTTCTTCTTCGAGAGCGAGTTGCGCGAGATGGCGTTGATGCCACGGGCGAGCACCACGTTCTGGCGCTTGCCGGCGGCCTTGG