Description :
From Genome Similarity Track
Location :
Scaffold_475:9630- 12125
Sequence
2495 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTCG
ATTACAAGATGCGGAAGATAGTTTAATATTTAGGCGAGCAACCACCAATGGGGGCCGCCCCTGCCCACCCGCACCTCAGTGTGTGTGATAGTTGGGTGGG
CTGGAGGCCCTACAAGCCGACGAGCCCCATAGTGTAATGAGGGGTGCAGGATCTAAAGAGGACCAGCGTCATTGAACCCGCAGGACACCTCCTGGTGTTC
TGAGGAAGCCGCGCGGCATAAATCTCTAGCCGAATATAGTATAGGGATTCTGTAAATAATAACTATTTATTCTGGTTCCGATTTGCAGACACAAGCTGCT
GCTTTGTTGACCGGTCATTCGTACATTTAAAGGATATTTTGAAAAAGATGAGAGACTGACAGCATACCATTTACGCGGTTGCATCTCACAAGCTGCCTAC
ATTTTATATAGTGCTTTCGCCTACTAAAAGAGTGCGCCACCATCGAAACGACGCAATGAGCTTGTGAGATTATATGCGAACAACTGCACCTTTGTTAAAT
CGTGTAATAAGTTGTCCAAATAGATCTCGATCTGTTTTGACAGCTTAAGCTGATCACGTGTTGTTCCGCAGTCCGACTGCGAGAGTTGTCCGAGCTGATC
ACAATGATGTGGTGGAGTGGGATTCGCAAGATTGCTGATGCGATCTCGAATCTCTACTGGCGCCCAGACGACTGACTAACGGAGGGGTACTCCGATTCCG
TGTAGATATATTCCTTCCTCACCTTGTGTACTCGTCGGTAGAGCAGATTGCGCTCTTCTCGGTGGACTTAGTCGATGCCGATCTTGACTGTGTTTGAGAT
TGGGGTCGCGGAAATCTTCACACGATCGAGGTTATCTCGGGGCACTCTATTTGAGTTGCCCGGATCTCCCTTGAGATTGCCTTGTCCAAAATGTCGATAC
TTGATTCGCGAGCCTTCTGACCACTTGATCCGTCTCGCGATCTTGTACCTGAACCACTAGGGTTCACTGTGTCCAATCGGAGTTGGGGGGGGTGAGAGTT
CTTACACACCTGGCCAAATAATCCAGGAGTGAGGTTCTTGGAACAAACGACGATCCTCTTTATACGTCGGGAGGCCAAATAATCCTACCCGGAAG