Description :
From Genome Similarity Track
Location :
Scaffold_50:962677- 967197
Sequence
4520 bases(100 bases per row)
TGATGTGCCTCGAAGAAGGTAAATTGGAAAGTGAGATTGAAATCGTTAGTTGTTTGTAGGTTACGAGGAAGTGCTTGTTAGCATTCCCTTGGTATCCTAT
GTAAGATATATGCATTTCACTATACTAGATTCTAAGTAGTCCTTGAGTCGAATCTTGAAGTAGCGTAGCGTAGTAGTGAGCCGCGGTTCATTTGAACCGG
GTCAAAATCTTCAATGTGAATTCAAATGAAAAATAATGACTGTCAATGAAATTCCATGTTTGGCAATACTCATCCAAACATGGTGATTGCCTTCCGGTCA
GGCGCTTGTCTGCCTGGCCGCTCATTGGCAACTTAAGAAGACAGTTGGCAGTCAGCAAAGACAAGAAGGAAGGAAATAGAAGAAAGTAGGACGCATTGGT
ACCAACGTCATGGCCTTCGCTGGCTGTGACGCTGATGCGTCGTTACAAGGCAGCCCAGCGACGTAAACTGGAGGAACAAAAGGTCGAACTTCATAAGGAG
GAGCTACAGCTGCGTCGTAATGAGTTGGAGCAACAGAGGCTGCAACAGGAGATGCTACACCAGCATATGCAAAATCAAGCTGCTCAAATGGAGTCGATCT
TTAAGTTGCTAGCTGAAGCTATTACCAAGAAAGATAACTGAACCAAAGGGACAATTGCGAATGAGAAAAATAGTTTGTTAACGTCGGTGGATCTAACTCA
AATATTTACTGTTGCTGTTTCCCTCGCGCATAATGGTAAAGCAATTTGTTAATACAATTACAACTTTGTAAAGTGTCGCCACAGGAGCTCCACCCAGGTA
CATCTTCCTCTTATAGTCGACACCCGCCCAGAAGCTAACTACCTGACCGTAAGACCATTCAACCGTGGCTCTGACCTCCGCCGTGGAGGCATTGATCGCA
GTTTGAGCTGGTGTCAGACTTGATCCCTTAAAAGGCGAAACAAACGCGTCCGTTCGACCATATGCTTGATCCACATATATAAAGTAGCCACAAAATCTTT
CATTCGCACTTATGCGTTCCTCTAGCCCCGATTGACGCAACAATACAGCGACATGCCTCCACCCTTTCACCGGTCCGTAAAGGTGAAAGATCATTCCATC
GGGAGTGACGACGCTCTGGAATTTTAGCCCACGCTTTCTTTTGTGGTGGGAATGCAAACTTAGCTGGTCTCGAGCTCCTCCCGGTCGGCAAATGCCCCGT
ACAGTCCCATCCACGAAACCCCAAACACAGTCTAGCTTGCCTCCTTGGTTGCAAATAGCTTCACTAAACGTTTGCAGTCTAGAACTAGCATATTCTAAGT
CCCCCAGTAGTAATTGACCACACTTCCCACTAATCAATCCGATGACAAAGTAGAAAATACTACTTAGAGCACTTGGCCACCTTCCGTAGATTGTAGCCAT
ATGCATCCATCTTGTAGGGTACGCTAGACGGTGAAGTGTGATACAGAGGCCATCTAGCCCACTACAGCATGCACGCGAGTGCAAACCTGTCCCGATCACT
TCCGGTAACTCAAACGAAGCTTGTAAACGTCGAAGTTGTCGGTGGGTGAATCTATAGAAGGTCAGGCATGTGCCGTCGGTGACGTCGCTGATATGAAATC
GAACACCTAGTAACGAGAACCGAGGTTTGAGTCATAGAGTAGCGTCAGCCTCCGATAACGAAGTCTGGAAGCGGTCTCCCAGTCACATGTAGTCGTTTCA
TCCGTGAGGCATCCAGCATCTCCCTTGCCACGCGACGGCACTCGAGAACGTCGTCGTCGCTGTCCGATTCCATCTCGTTTGGAGGGCGTAGATTTGACAC
TAGCTATCAACTGATTCCGTTTCTTTGTTGAGAGCGCAACGCAACTTGTCACCCTCAGACAATAACACGAAACGAATAACAACAAAATTTATCAGACATT
CTTAGATTTTAGCTTCGTTCTGAGCTGCTTAAGCTTTCTATTGTCACAGCGAGTCACAATCGATACATTTTGTTTTAAAGTGAAAGAAAGTTGATACATA
ATGTGATCGACTGCGGTTAGGTGACTACGCACAGTATCGGTAAGTAGAGGTCGACTGTTGAGCGTTTGACAAGCGAGTGTGAAAACATGTTTTGACATTA
CGGGAGAGGGGGCGAGGAGAGAAAACGCGCGAGGGGTCGCTCCCCTGTGCAGCCATTCATTCAAAATTTACCGATGGCAGCCAACACGTATCTCGCCATC
GAGAACAGCGCTGCGGAGCAAAGCGCCGCCCAATAAGTTGTGGTGGACAGTCTCAAGTGCTGCACACGCAACACTCGTCGCAGCTACGAGCCCAAACAGG
GCGAGTGGGCTAGGTGGTGCAACGGCCGTCAGTTTGTTGATGGAAGTGTCGTGACCGAGGGCAAGATCTTGCCTTTTCTCGAAGAGGTGGTGCGTCCACG
TGGCTCGCGGCGCAAGCAGGACGGTACGGTCATTCTCTCTCGGCGGAGGGTATTGAATGGTATATGAAGGCGTTAGTAGACCCCTACAGCATCCAAAAGT
CTCTCGGTATTGGGTCCCACCCACATCCGTGCGGCAAGGCACTTTCTGAGTACTTGCGCACCCATAGGCGCAAACGAGCAACGCGTCGGCGCGAAGAATT
CGATGACCGTGGCAAAGGTACCGTGCAGGACACGTACTCGGTCGGCCAGCTACGCAATGTGTCAGCATACTTTATGGAAAAACAACGGTAGGGCTCTTCA
CGATCGAGTTGACATTCGCTTCGGTCACGCGCTTATGGCTAGGGGGGAGACGACGAGGGAACTTCAGCTACCCGATCTATTCTCCAGGGAGCTTTCAATT
AAGGCCCAACGAAGTGCGTGGCGGCGCTTGCTGTAATTGAACCAAGGCAAGATGAATCAGTTTGGCCGTATCGAATACAGCGGCTGTATCCGATACCGCG
ACGTCATCCTGTCCCTATTGGAGCCCTGGCCATATACCTGCTTTGGCGGTTCCATGTAATTGGGGAGACATTTCCGGACATGCGTGTCCGATCATCGTGG
TACAACATCCAGCTCATCGATGGCAAGATAAAGGAACGCGAGATATCGTACAGCGCACAAGCTAACGGGACGAAGAAGGCCCTGAAAGCGTGCGGTGTCA
CAAGCAAAAAGGTAATATGTAGCTTTGTGTAATATGTTATGATGTTAACAGCGTTTAGCATCCCACAGATTCACATTGAATCGCATGCTTTCACATCACA
TGGATTAACACTCTTCCTTATTTTAACTTGCAGGTGACACACATTTGCCGACTAGCTCGTGCGTCATCGCCAAAGCGAATGGCGCATCCGAGGCCAGCAT
AAGAAGGAATGGGAGATGGAGCAACGAGAAAGTGGAAGGCTGTTATACGACTACTTTGCCGCGTGAGGTTGTCTGTGCGCTAGCAGGTTTCAATGCAAAT
TGGGGGGGCATTCTTTCTGCCTCGGGCTGAGAGTTCTATACCAGAAACGTTGCGAGGAGCAGTGCTGGCATGGATTGACACGTTACAACCATTGTTTGAC
AAGGGAGACATTCATAATATAGCAGGGAAAGGGTTTTTGCGTCTGCTCGCATATCTACGGGAAGTGGTACTTCAGGACTCTGTGCTCCTCCATATAGCTA
ATCCAACGCATCCAATCTGGAAGCACGCTCTATTCACAAGACCAGACTACCATATATTTGCTAATCAGCAACTAGCGCGCCTCCAAAAGACATCTGACAC
CGGATTGATCCCTACGGTACGTGCCACTCTCCCTATTTTAATCAACGTGGCGGAAAGCAGCTTCGCAAGCACAGTGCTGCGTCTGACAGCTATCGAAAAT
CTTTACGCTCTACACACACGCTTGTCATCTCGCTTGTCGGCGGACGATTTCACTCGTCTTAGCTCCTGGCCAGGCTGGACAATCGAGCGAACAGGCAGAG
CAATTGGACGGGTCCATTACCTACCGTCTTGCTCGAGGATTGTATTCCGTGATTGCAGTTTGGACAGAGTACACGAAAGGGGTTGCGGGTTGTACCCCCG
TACAGCAATTCGAAGCACGTCACGGCGCGAAATGGTGTTCGAGTGATTCCGAACGTCAATATTTCAAACGTCGCAAGGTGTTTTACGATGCAATCCAATT
CCTAGCTGCAAGTGAGCACGCCCCCCCAGAAATTATAGCGCAAGTACTGGAGACGAAGCGCAAAAACATGAGCCTCATACTTGACGCCCCGAAGGAAAAA
GCTGAGCGACAAAGGCGGGGCGATCGCAGTCTTTCAAAGTGCATTGTATTGAGCTTAACCTGACACAGAATGACATGATTTCACAGCAGCATTCAATAAT
ACCGTTTTGCAATGTGAACAACATTGAATAACACCGGTGTTTTTTTATTGTAACAGTTAATGTTCTTAACATCTGTTGTTAAATATATGCTGTATTTTGC
ACAATCCCCCCATTTCAAAAGAGCACTCGTTATTCAGCCAGACTGGGTAACAAGAGACAGTACAATTACACCAGAATACACCCGATAGCATGCCCGAGTT
TGCCAGACTCAGGAAGAGCC