Description :
From Genome Similarity Track
Location :
Scaffold_2:9623- 14546
Transcript NameFunction/comments
Phyci_88939acyltransferase domain containing protein
Phyci_207186conserved hypothetical protein
Phyci_75785cell division protein ftsZ

Sequence
4923 bases(100 bases per row)
GGCGTGACGCACACCAATGTGGACAGTCGCGCGCTTCGACAACGCGACAAGAAATTTGTTGTCCGTCACACGATAGGCCTCGCAGCGAAAGCCGCTCGGC
TCAGCAGGGCGGACCATTGCCAGCGCGCATTGCGTCTGTCGGGGGGCCGCTACTGTAGACGCAGCGGAGCTGCATCCGTGCGAAACCAACTAATACATGC
AGCTGGGAAACGGTTGGAGCAATCCGGCGGCAGCACCCGCGACCGAGCGGAGCCAGAGGCGCGCCAAGTTCTTTTTTGTGAGGCCGATCACATCGTGCGC
ACGCGCAAGGCGGACGTTCCCTATGCTGCATCAACGTGGGACGTGCCAGCGTGCCTGGCTCCACCGAACTCCCGATCCCGAGCTACTCGCAGCCCGCGAG
CAGCGCTCTTTGCTCGACGCTCGACGCTCCACGAGCGCACGACCTCCGACGGCAAGTGCGAGGCGGTTGCTATCTTGCGGCCTTCGGCTTGTGGCCGGTC
GACACAGCCTGTGTTTCACCCCTGCCTGTCGTGCATGTAGTTTAAAGTGCTGGTTTCTGATAGCACTGGAAGCACAGCTTGCTTCAATTGCCGCGCAGTT
TCACTCGTCCGGCGTTGCGGAACGGTTGTTGCCTGTCTGATTTGCGAGGCTGAACTAACGGCGTGAGTGCCCTAGTGAGCCCGAGGCCCGAGCCCTCTTG
TTGTGAAACCACACACAGGCCCAGGTGTTGGGCGCTCGGCACTCGGTGGCCGAGGGCTGCAACTGGCGTAACTCGATCGTGGCGACGCAAACGGGCCACA
GCGGATATCTCAACGCAGTCGCATACACCATCCAGCCAGAGCGGCTATCCAGCGTCCGCACGTGCTGCTTGCAGTCGGTATTTTCCAGACCACCACCCCA
CGTCACTCTTCGGAGCCGACGTACACAACCACGCGCAGGCCCAACCAGCAGCACTGTACCATATCCCCCCACCCGCGCCGCAACGCCTGTTCAAGCGGCG
GAGGAGAGCGTGGCGATCGAAGCCCCATCAGCGAGCAGTGAGCCATTTAGCGTAGCGTAGCGCAGGGACCCGGACGACTGCCGAAGTCTTAGTCGAGCAT
GAACTTCCAGAGCGGAGTGCAGGTGTTCATCCCGGCGGCGCTTAACAGGCCCACGCACACGCTCTACAGCATCTGCATGCTGGTGCAGCCCACGAACCAG
GAGTGGACGGTCAACCGCCGTTACTCGCAGTTCCTGCAGCTGCGCAAGGACATTCAGCACAAGCTCGGCACGCGGGGTGTCTCGTGTGCCAACTGCGCGA
GCTTCAACCGCGCCATCGGCAAGTTCCGCTTCCCGGGCAAGTCGCTGCTGCGAACCAACTCGGTGGTGCGCCACCGCGTTTCAGCGCTGCAGGACTTCCT
CAAGCTGTTGGTGGGCCGCACGTACAATGACCTCCCAAAGTGCGGCATCTGCGGCGACGAGATCAAGGACATGATGCGGCCGTTCCTCATCCGCGGTGCA
CAGCCGATGAACGGGTCCATTCTACCCAAGATCAACAAGTCGCTGTCACTGGAGTCGTACGCCGTGGTGGACCAGCCAGTGATGCCCGTACCGGAGCCGG
TGCCGCCCATTTCGCCCTCGTTGGTAGGCAAGGAGCTCTTCAGCGCCAGCAAGTCGTCGAGCAAGCCCATTTTCACGCATAGTCAGATTTCAGGCGGCAA
GTCCATCTTCGCGCGCAGTAAGGCAATGATGAGTACGCGATCGGACGATGCATCCACGCAGCCGAACGAATCCGAGGACCCCATTATGGACTACTCGGAC
AGCGATGATGACGGCTACGGCAAGAAGTACGATGACCAACGCTGCTACGATGAGGGCGTGCCGCTAGAAGAAGCGATGAAGCAGGTCGTGGTGCCCAAGG
GAGCTCGTCTTACGTGCGAAGAAGTGGTTGTCCGGCTCACGTCGATGTGGGCGGCTTACGACCTGGATGAGGCGCTGTCGTCCTTGCCGCCGGAGCGTCT
TTCGCAACAAGCCACCTTCTCTGTAGACGACAAGGAGTACGCGTTCTAGGTGTGGTGTTGGATAGTGCAATTTTGCTTTCCGCCCCTTGGGGTAGCTGCT
ACGCCGGCCGACAGAGCCGCACCGCTCCATGGGTAGGGCGTTGTCCAAACTAAGTATGAAGCAGTCAAGTATAATATCAATGCGACCAGCACATGGCTCC
AACTTTTGCAGTGTAGTCTAGGTTACTACTTAGTACTAACTTTCCTTCATCACAGAGAATCAAGCTGAAAGAAGAAATCACTAGGTTTCATTGTTGGTTC
TTCCTGTACGCTTGTCGAACACCATCACGATTCAGCTTCTATAACTTTTCCGGGTCAGCGATACCGGTAGCGACAACGGAGACGCGCAGCTTGCCATCCA
GAGAGTCATCGAATGTCGAGCCGAAGATAATGTTGGCGTGGGGGTCGTCCAGTTCTCGCGTCACCCTCTCCGCAGCTTCGTCGACTTCAAAGAGAGTCAG
GTCGGAACCGCCAGTGATATTCACAATCATGCCCTTTGCATCCTGCGAGTCGCGAAAGAAAGCGAATAAGATTCTAGTTAACACAAGGTGATGAAGTTAC
CAAGTGTAGTGGTTGAAGCAATACATACCTTGATCGAGATATCTCCCAGAAGAGGATTCGCCAACGCATCCTCAGCAGCACGCAAAGCCCTACAAACCAC
GGCAAACGCAAGCACTCTTAGCAGCCAATCCCACATCGTACCTAGCCTGTCAAAAGCCAGACGCACCGGTTCTCTCCATCGGCCTCTCCGCTTCCCATCA
TGGCATTTCCCATATTTTGCATCACCTACAGTTACAGTGATAAACATGGGATGTCAACAAGGATGCCACCGAATGGACGCACATAGATCTACATACCGAC
TGAACATCCGCGAAGTCGAGGTTAATAAGCCCAGGCATCACCATGAGATCAGAGATGTTCTTGACGCCGTCCAGAAGCACATCGTCCGCCATTCTACAAC
AGAGAAGCAGACAATAGAGGTCAGTATTGCTCGCCCAGCAGCTCCTCGAACACTTGAAACTAATTTTCGCACCGGAATGCATCCATAAGTGATGTCCTCT
CGTTCGACATATTGAACAGATTTTGGTTCGGGATCACAAGCATCGTATCCACGCTATCCTTGAGCTCAGCAAGCCCCTGTGCTGCAAGCTTCGCCCGGTT
GTTACCTTCGAACCGGAATGGCTGCCACGTGCGATAAAACGAGGCAGTTAGCACATGATACCATTGTTTGCGGCGAGACCCAACCGGTATTTATACCTTC
GTGACGACGGCAACCGTCAGAATTCCAGCATCAAGAGCTGCCTGGGCAATGATCGGAGCTGCACCTGTACCAGTTCCGCCACCCATGCCTGCAGTCACAA
ACATCTGCAAAGATACAGATAATGAAGCGAGCGTCTTAGCATCATTCTACAACCAATCAGCTTTCCTTGAAAGTCAAAGCTACGAACCATGTTTGCACCT
TGGACGCGTTCCAAGATCTCATCAATCGACGCCTCCGCTGCTTCACGACTGGATTGATTCGAAAATAGAGCAAGTTTAGACCATCCAACACCCTTTGCAT
CAGCTGCAGAGGTAGCATCACTTACCCAACTTCGGGGTTGGCACCGCATCCCAGGCCTCCTGTCAGCTCAGGGGCCATCTGGACGCGGTTCTCCGTCAAG
GTCGTGCGCAAGTGCTGTGCATCCGTGTTGCAGACCAGGAACTCGACGCCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGCCAATCAAAGTTCGTCAC
GATCGATACGTAAACTACCTTACGGGGGTCAATGCCTCCACACTGCTGCACGCACCAGCATTTCCTCCAGCTCCACCAACACCAACCACCACAATCTTAG
GCGCGAAAGCCGACAAGTCCGTCACGGGGTGCTCCTGTGTGAGCCACAGCGGCTGCGTGGAGCTCATGGCAGGCGGCACGAGCTTCTTCTCCACCACCGG
CGGTGGCACCGCGCTCACATCGGTCGGCGACGCAGGCTCCGTGTCTGCCTCCACCTTGAGCGCGTCGTCCTCGTCCTTCTGGGCCTTCTTGAAGCCCTGT
CAATTATTGACGCGCAAAACATTGTGATCAGAGGCTGCAGTGTGGCGCTCTTCAGGCAGACCGTGCAACAAATTACCATGCGCAACGCGGCGGCTGCTGC
GTCGGTCGCTTCGGTCGAGAAGGCCAGGCGCTGAGTAGCGGCCTGGGAGGCCTGGCGCACGCGCAGCAGCGCCGTCGCCGCGGCCTTCATGCGGAATATC
GCCATCTCGGAACTGGATCGCCACAAAATGAAGTGCTTTGGATCGTACTTAACCGAACCGTGATTTTCTATTGTGAAAATTATTTATGTAGCCATGTCGC
CTGGTTGCTGCTCCTGGTCCTGGCGGCGCAGCTCGTCCACGTTGGCCTTGATGTACAGCAGCACTTCCGACTCGGTCAGGTCCAATTGCACGCCGTAGTT
GCGCCCCACGAAGGTGCTGAATGTGTCGACGTCCGAGCACAGTAGGCGGTTAGTGTCGGTCCAGATGGCCACGTCGCTGATCACGAGGTTTGACGAAGTG
GGCAAGTTGAAGCTTGTTCCAAGAATCCAAGAAGCAGAGTTAGGGCAACCAACAGTGACTCTCGAAGATGGCTGTAGCACTATGCGAGTCGTACCCGTAT
CGCCGCATCAGTTCGGCAGCATCGTTGGGCCAGCGGTCGGTCCTTGAAGGCAGCTTTGTCACTTGACAATCGGGCAGGACCGCGGTCAGGATGTCTGCAC
AAAGCGCAACAATCAGAGACAGTCGAGTGACGCGAGAAGAAATCATGCCCCCATACCAAGTAACCGGTCGCAAATGGCGTACTCCTCACTGCTCACGCGG
CCAGCAAGCGTGTAGTGAACCAT