Description :
From Genome Similarity Track
Location :
Scaffold_206:9622- 10980
Sequence
1358 bases(100 bases per row)
TGCTTCGAGTCGCGGTGACTGATGTgTGGTCAGCTATCCGAAaGGAAAGTGCCTGTGTCGCCTCAACGATCGTTGTGCAGTTCCCATTtGTTGAGATGAT
CGATCATTTCATTGAATCGCTGCTGAAGATCATGATGGGTGATGCGTGGAAAGCCCAAGAAGGCGCTCTCATGACGATCACGCGCCTCATTTCGTCGATA
CgaGTTCTCAAAGGGACGGAAAAAGTAGTGAGCTCACATGAAGCAAGTGCCGTGGACATGATAAAAGGCGGTGGGATTCCGACAGGTAGCGTGGGTTTTC
AAATCGGCTCCGCACATCGTGGTTTGACCCAGCTGCCTTGCTCACTGGTTGTGAAGCTAAAACCAGCACTTTATATCGCGCTAAAGCACAATCAAACATG
CGTGCGTGATGCCGCGGCCAAGTGCATGGTCCAATTCCTTGGCATTTCAGATACCACGACGAGAGTGTTGATGTTCCAAGAAGTCATGAGCAAGCTCAAT
CGATTGCCATCGGTCGATGCTACTTGCCACGAGCCGGACGATGAACTGCTCGAGGCCTTCGAGGCTGAAGGACTGCTTGACGTTCTAGCCAAACTCATTC
CtcATCTCCCcGTACCGTTTCTCATAAAGCACTGGAAGTTTGTATTCCCTACGCTGGAGAGATATGTTGTGCACATCGCATCCAGTGTGCGCTTGCGTAG
CAGTGCCGTCATTTTGGCACTCGGTGAACTCTCACTCACCGAAAACGCCACTGATCAATCCCTTGATTTACTCTACCAGAcGATCGTCGCaCTAGCAGAT
CTGAGGGATGTAGTTGGcGTGAGCTGGCAGCgCcTTGAAGGTCGTCTCCTGAGTATTGATTTGCTGGTGCGTCTCCTCGGAAGAGAAAACTTGTGGCGTG
TTGATAAGAACTTACTCCATTTTCAAgagAGACCATCAGCACTGACTACAGAAGGTTGGCTCTCAAGTTCCATCAGACCCCAGGCAACTTGGTCCCTCGA
TGAGGATGCTGAACGCTCTCTGTccAGACCCCcAAACTTACATGAGTCCATTATCCAGCGACTGGGCTCTTACGTGGTAACTAAACGCCAAGAGAGTCGC
GAGCTATGGCAcAaGGTGCTTGCTGGCTGGCTCGCACAAACACAAGCCGCTTTCGAGTCCTCTCAGTTCGAaTTACGGCGCATATCAAGGCAGGTACTAC
CAGGTCTAGTGCGGTTATGTGTCTGGTGCGACTGTTGTTCGCTTCTGAGTTtcGATCGGAGCCTCAGATCAGACGCCAAGCTCCCCAAcGACACCACAAT
aCCACCAAGTGCGTGGACTCGGACCTGCTGGCGCTACGCGTTGCTTCACATGCAAGAT