Description :
From Genome Similarity Track
Location :
Scaffold_76:9611- 10612
Transcript NameFunction/comments
Phyra_82685reverse transcriptase

Sequence
1001 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTCGAA
TTCATTTGTGTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACG
CTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAA
GTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCTATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCT
TATCCGGTTGTTTCGATTTAACCGGATACCCTCCCCCACTTAAGGAAGAAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCAC
GTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAG
CTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAGTG
TAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAA
ACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTG
T