Description :
From Genome Similarity Track
Location :
Scaffold_1444:961- 2068
Sequence
1107 bases(100 bases per row)
TGACGAGGAAATACGGAGCggccaagcagctgctgtcaGTCAGCGTTCATCAACCCCTGCAAGCAGCGAATACCCGCGGAGATAGAGCGAACCCTTGCAC
CGGAAAGGCCCAGTGCAGTGGTATGAGTGGAGGCAGGCCGGGCGTTCGGGCCTTGGTTGGAGTCCCTCGTGGTATGGTCCGAAAGTGAGTTATCCTGAGG
ATGGGCGTCCGACGTCCGGAAGACTATATACCGGTACACTGTACGTAGTGACCTAACGCGCTCCAAAAACCTCCTGAAATTTGGTGGTTCCTTCGAACTA
ATGGATTATTTCCTTCAATTCACTGTATTTTACTATGCCATCTCCACCGAACCTCTGAGAATACATTCTTCAGATTGCACTGTGACAGAGCACCAGTTGT
CCCTGAGATTGGCGAAAGCGCATCCCATCGCCACGCTTATTGTTGTTCCCAGCTGAGACGGTCGAAAACGCATCTCCTTAAATCGAGGGGAGCTCGTCCT
GAgcctccgtcttcttcgcccGCGCTTTGTCTCTTCATGTGGTGCTCCGTATCTTCTAGTCTGGCTGCGAGTCtttgctgcaacttgcaagtCGGGACTT
GGCCTCTCTCAACAAGAGAGGCACGCATCCAACCATAGAATATCTGAGTGCAATCACCGGTGCTGATACGCCGAGATTAAAACGTATGGCCGCGGCCTTG
CACCGCGAGTTGGCTGCGCTTGCACGGCTTGCCTCGTTTTGCGCTGGGCCGCCGCTCATTCGCAGTTCCGCAAATCTGCAGCGGCGGATTTTGATACAAG
ACTTGACAATCGCGCGCTGGAGGCGACGGAGGCTCTTTAACTCGCTCACTTTGGAATTTTCCTCTTCTCGGAGAAGTCCccaagccagcagcagcagtca
gcCGATTCTCACTCGACTGATTTCTCTCTCCCTTCCTTTCACCATGTTGGCTCGCATGTCCGCCACGTCTCAGGCGCAGGGCGCCACAGACAACAAGtcg
gccttcttcacgatggaggacgccaaggccTCGTTCAACCTCTTTTGCTGCGTGTGCGGTATCGGTTCGCTGGCCATGCCTTCCAACTACGCTCGTGCTG
GGCCTCT