Description :
From Genome Similarity Track
Location :
scaffold_6:96068- 117082
Transcript NameFunction/comments
g405.t1 hypothetical protein PHYSODRAFT_561482
g406.t1 protein kinase, putative
g407.t1 conserved hypothetical protein
g408.t1 conserved hypothetical protein
g409.t1 hypothetical protein PHYSODRAFT_286379
g410.t1 conserved hypothetical protein
g411.t1 hypothetical protein PHYSODRAFT_262124
g412.t1 myb-like DNA-binding protein, putative

Sequence
21014 bases(100 bases per row)
CCAAACACACGAGTCGTCGACAGAGACTTTGCTTCGCTGCGTACTCACAGTACTGCCCCGAGACGAACGAAGCTTTTTACACCATGAAAACCTTGCCCAA
GCCCATGCACGACAAGTTCACCCGCCGCAGAAACGAACGCGCTACCAACCAGACAATTCAAGGCGACATGGAGCATATTTCCGCTGGCTATCACCTAGCG
AGTTCGTACAGCAACTTGAGTGGACACCAGACGCGAATTGTCATGACTGCGTACGTCACCAGTCCACCAGCTCCGGTATCCAACGTACATCGAGCTCGTT
CGCGGTTCTGGGGGAAGGAACCTTCTGGTTCTGCACGACACTACGCACCACAGAGCGCCAATGTAAAGGCCAAGTACGTGGTGAACTTACTGGCTGCTGC
AACGACGTCGTTTGAACAGCTCGTTCGCCGTCGTCGTTTGGGATACCAGCCAATGCTGCACATGCCCGTAAATCCAGACGCAGATCAAGACGACAGATGC
ACTGTATGTCTTAAAGCTTTCGGGTTGCTGCGTTCACAACGATTCTGCCAGCTCTGCGCCCACCGAGTCTGCCGTGAGTGTTCGCGGAAGTTTGCGGTGG
AGCCCGTGGCGCGCAAAGTGCGTCGCAATCGAATCTGCTTCGCGTGTGTAGCTCATGTGGACGCCAGCGTGTTCCAACAAGATGATCCACTCCCCCACTC
TTCGTTCCACAGAGTTTCAACTGCAGCAACCGCCGGCACCGCGAACATTCGGCAGGTCGAAGATGCCGGTAACACGAAGATTTCAACCGCCTTCTACGAC
ATTTTGCTCAAATCCGACGATACTGTACGCTTTTCTCAATCAACCGATGCCCGAACAGCAACACACGACGCACAAATGCACCGACTAGATCGCAGCAGCA
GCGCAGCTACCGCCTCAACGTCGTTCTCCTCAACTCCCGGCCGACAATTAGCCGATGCGCTGTTTTCAAGCGACCCGTTGACCCGAGCACGAGCACTGGA
GATCGTACGCCAAGTGGTGAAGCAAGTGACATCCAACTCAGCACCAACGAGTTCGACGTCGACATCGTCTTCAACGTCCGCGTCCTCGATTCCAGTGTTT
CACCCGCAGTATCCGGACAGGAAAATGGTCGACAAGTACCTGGAGGCACGTCTGCACCTATCGAGCATTTCTAAGAGCAGCGACCTCAGCAGAGAAATCC
CATCCAGTCGTTCAAGCTCGTCATACAACCGTCAGGAAGTGACACAGCGCCATCGACGCAGTACCAGCGGCAAGTGCTTCTCGTCTTCGGTGCAGCTCAA
TACTAGGACTTCCGTCGTGCCTCGACCGTGGACGACAACGACGAACGTGGAGGTGGAACTGGATCTGGACGACGACTTGGACTCTGCAGCGCTTGACTCA
ATCTGTGAGGTTGCTGCTGGCCGAATGCGATGCTCCATCGCGTACATTGTGGCGCTCAACGTTTCCCACAGTTTCCACTCTCAGCGAGTCGTAGGGTCTT
CCGGCGCTCCACGTCCATGGACTGACGAGGTGACGGTGTGTCCGTTCTCTCTAGTGGCTAACGGCAAGCCGTTCGTGATTAAGGACCCATTGCGAGACCC
TCAACTGCGGCATGTGCGTCTTGTGCGCGACATCGGCGTGCGCTTCTTCGCCGGATTCCCCATCAAATCACCGGACGGCTCCGTCGTTGCCTGCCTGTGC
ACTCTGGACGCCAAAATCCGAGAGAAAATCTCACTGGAAGACCTCAGGGCCATGCACGCGCTGTCCAAGCTCGCGTCGGATCTATTCGAGGAGGAGGTTA
ACCCGTACACGCCCCGTTAGTGATGAGTGACTTCAACATGCAGTTATGTTTCAGTTAAATGTTACAATTTCAGCTTCAAGACTGAAATCCATTTCTGCTG
TTCTGCACCCCACGAGCTCTGGACCATGCGGATGCGACTGCTAACGCGCTTAACGCGCGCGCCCGTGCGCTCGAAGGCGGCGCCGACGTCAGCGGTGCAA
CCTGCGCCCATCCCAAAGCCGAAGAAGACGTCGTACAGCAATGGAACGGGCTGGGTGGGCTTCGTAACGACGGCAGCGGCGTTAAGTGTTGTTTACCTCA
TGCATCGAGACGCACCCAGTAGCGACGTCGAGTGTGGATCGAGCGATGGCGCGTGGTGGAAGGCCTCCAAACTGGATCAGCGAGGCCACTACGCTTTGCT
GAAGGAGCTCGGCAGAGGAGGTTCGAAGGATTGATGCTAAATGGAAAAACCGTAGGAATACTAAAGAGTTTTATTGCTCGTTTCTTTGATTTTTAAGGGT
TTTCAATTGTTCGTCTTGCAGTTGACATGAAGACGGACGAGGTGAGCGATATTGGTGGTTGCTTATGACTACGCGAGGGCTGAAACTTTTGCTTTTTGTT
TTACGTTGATAGATGCTGGCAGCCAAGATTTTTGACCCAAAATGCGCTTCGACGGAAGCGATTCAAGCTGAGGTATGTACAGTCGATAATTGTTGCAAGT
TTATGGGCTAAACTGGCTGGTTATTTGTCACAGATTGATATTCTACGGCACCTTGGCGCACAACGAAACATTGTGTCGCTGCATGATGTGTTGTATCTCA
AGAATGAGACTATCATGCTGACGGACTTGGTCGAAGGAGGAGAACTTTTCGACTATATTGTCGATATGGTCGGTGTAGTCTGCAATTGTCCGCGTATATG
TGTTTAATCGAGTCTAAACTGCCATTTTCAGGGATCAGTATCAGAGCAGGATGCAGCTCACCTGCTACACGATGTCTGTCAAGCACTTGCCTACGTGCAC
TCACGTGGAGTCTGGTGAGTTTTTAAACTGCAAAAATGACGTGGTTGAAATTTCACGTTTGCTGTATCTGCAGCCATCGCGACCTAAAACCTGAAAATGT
TTTACTGTCAGACCGGTCCGCCAAAGCAAACGTCAAAGTAGCGGTGAGTTAGCGCTATTTAAGCCTCCACGCTGATAAAGTATTAACTTTCCGCTGGTTG
ATTCAACGTCAGGACTTTGGTTTGAGTCGGCGACAGCAACAAGGGGAGCAGATTATTGAAAAATTTCCGAATGGGACTATGTAAGTTTACTCTTGCACTT
GTACGATTCTCCAGACGACTAACGTTGCGTCTATCTAGCGCGTATTGGGCCCCTGAAATCATTACACGCCATCCTCAGGACTTCAGCGTTGATATGTGGG
CATTTGGCGTTTTGGTATGAAAGTGACGTTTTACCTCCCTTTTCGTGGGATACCGATGCTGTCGTTTTTGTATTGCTTTAGGCCTATATCACGTTAACAG
GAGTGCATCCATTCGACCCGCGAGGCGATAAGTCGGACGCTGAAATTGTGAAAGAGATTGCGAATGGAAGCTATGATGGTAAGTTCCATTGCCAAAGTAC
TTAAAACTTTCGTGTTGTGTACTGATTCATCACGCAGTGGAGAACAAATGGTACAAGAGTCTTTCTGCAGATGCTAAGAACTTCTTGACGCAACTGCTTG
ACTCGGATCCATCCAAACGGTTGACTGCCAAGCAAGCGATGCAGCATCCATGGCTCAGTGGACTCACGACGTCAGCAGAACCCTTCGATAGTGGCCACAC
TCAGCGACTTCAATCGTACCAGCGTCTGCAGCAACTCCGGGCTAACGTTTTGGCGGTCGTCATGGGTTTGCAACACGCTAAACTCGGTAAAAACTCTGAT
GATGATGAACAGCACCTCACGCCCAACCGCACATCGACTGTGAATATGGACATGTTCAAGGAGACGTTCGCTCTGTTTGATAAAGATGAATCTGGATGCA
TCGATCAAAAGGAGCTTAAGGACATGTTGTTGGCTCTGGGGCAGCAGCTTTCAAGGTTTGTTCGGTCTCATTTTTTTCTTCATGTTTCGGTAAATTAACC
GATATGATGTTGCTTACAGTTCCGAGATTGACGAGATCATGCGGCAAGCCGACGTTGACGGTGATGGGAAGATTTCATTCACCGAGTTCGTGAGCATGAT
GAATCAGCGGCTATTCCGTCGGTACTGTACAGATTCGCTTTGACCGGCTTACTCCTGTGTGCAATTGAATTTAATTTTTCTCAACTTGTAGCGGAGACCT
GACGGCTGGAGATCTCAAAGCTGCTTTCGATGTACGTTCCCGCAACTCTGTGGATAAACATGGTGATGATTTCCACTGACGCAGTTTGATTCTATGCGCA
GACTTTCGATGTCAACCACGATGGATTCATCACGAGCGTTGAACTCGAGCACATCCTTCATGTCCTCGGCAACAAGCACATCAGTAACGAGGAAACCTGC
AAGATCATCCAAGCAGCAGACAAGAACGATGACGGAAAAATTGACTACGAGGAATTCTGCGCTTTGATGCAGCAGCAAACACACATTGACGATGGAAACA
CAGGGGATGATGGCGAGCGAGGATGACAAGCAGCAGAACTGTGGTTGCTGCGGTAACAGGAAGTGCGACAATGCAGGGAAGTATCTCGCAGTTGCAAGTT
GCACATGAAGGGAGTTGAAGTAGTCGGTTCGAATGACTATGCATTGAGTTTGTCTAAGAAAGTCAAGTGCCAGCACTCAAGTGTGGAGGCGTTTGTTACT
GGATTCGTCTAGCAGCGGGTGCAATTTTTTGCGCAGCGGGGCCTGTTATCGAGCACATTTGGTTTCGAGACAACGACCGAGTTCCCAAATGTCGCCGAGC
ACGTATAGCTAGTCGGAATAAACGGGATGCCCATGCGGTGCTGCTCGTGCCGACGTAGATCCGATACGTCGCCGCCGCCATGCGATAGCGTCCATATGCT
GAGCTTGACGCTGTGCTCGGCCGTGGCACACAGCAATGTCGTTCGTTTTAGCACAGTTTTTCATTGAAAATTTTATTGTTCAATTACTTCCAAAACAAAT
ACTATGTAATACCATCGGTTTATCAGGAATTTAAATCGAATTAGTGAAGTTGAGAGTGTAGTCAGGTTACAGAAATAGTGTGATATACTCAGATAAACAG
ACATTGAGTTTCTCGATTTTGTAAAAGCTCATCGACTATCTTTTCAGCAAAGGGACGACGGAACCTCCATACTGAACGCAAGTGGCTCCCCACAATACGT
TACACCGCGCGGCAAGCAGAAGAGATGGAGGCGTCGGCCAGCGCAGTGGAGTGCTCGTCGCCCGTGAAGCCCCACGTGGAGTCGCCTCGTGCCATTGGAG
AACCCACAGCCGCAGCAATGAGTCCGTCAACTCCGACTGAGAGCTACGAGGCCGAGGTGGAGACGGAGAAGAGCCCCGTGGCGGCCCAACTGGAACTGCA
CAAGCCTCACGAGGACGGCGCTGAGTCAGACAAGGCGCGGACAGACAGTGACGACGAGGAATATACTGTTGACTCTGTACAGGAACCTACGACGCCTGTG
GAAGGCCCAAAGACGCCAATTGAAGCGCCTTCCACCCCTAGAGATGAACCTACGACGCCTGTAGAGGACCACGAAGAGCCTACGACGCCTGTAGAGCAGC
CCCCAGAGCAGAGTTTTGAGGATGAAACTGTTTCTGTAGTTGTCCATGAAGTGGAGCTGGAGGTGCAGTCGCCGCCACAGTCGCCAGTTAATGCTAAAGA
TGCCGGAGAGGTAGACGAGCAGGTCCACGAGGTTGAGCTAAAGGTACAGGAACAGGTACAGGAGCACGAAGTGGAGCTCGTGATCCCGTCGCCGAAACGT
CCGGCCCCGTTGAACCTGGTGCATCATGATATTGACGACGAGGCCAGCGATAGCGACGAGATGGACGGAGGAGCTGGTGACGATAATGATGAAGGTGCTG
ATCTTGGGACACCTTTGGGTTACGGCGGCGCTGCGGACTTCGGGGAGGGCCAAGACGAGTTTACGTCGCATCGCTTCTTAGGTCCCAGCGTGGCTTCTGA
TCCCTCGTCGGCTCGCGCACTGCACAGCTTGCGTCGCGTTGCACTTCATGACAAGCCGCCTCGCTTCGTTAGCGAGGCACCGGTCGTTGCGGCGAGCTCC
GGTAGCATGACGAGCAGCGGGGAGTCGTCGGGACGGAATTCGTCGAGTGCGAGTGCGATTCACGCCCCAGATGCCAAGTCTGGCCTGCGATCGCAATCCG
AAGCTGACTACGTGGAACACCCTCTCAACACGTTCTCGTTAACGTTCACGGAGCAGGTGCTGGGATTCAACACGAACGTCGTCGTCTCGTTAGAGAATGA
GTTGCTTGTCGAGGTTTGGAGTGTGGATAAGGACAGCCCTGCGCAGCGTGGCGGCGTGGTGGTCGGCGACTACCTGATTAGTGTGAATGGGCAGCACATC
GAGCCACACATGACCAAGGAGCAGGTATTTGAAATCATTCAATCGTCGACGGTCCCGCGTACACTTGTCTTCCAGCGTGACGTGCATGACAAGGATAGCG
CACAGTCCAAGAGCCTTCCTGACAAGAAGCACTCCCCCGGAAAGCCGCTTATGGGCCGTCTGGGTGCAGCCATGAGCCAAGGAGCGTCCATTATTGGCTC
CAAGTGGAAGCGCAAGAAAACGATCGTGCATGCGAATTCGTTCTGTGATGGCTGTGGTATGGATCCGGTCGTGGGCGCTCTCTGGACTTGCAGTGTATGC
TCTAATTACAACTTGTGCAGCGAATGCTACGACTTGGGCACCCATGGCATGGAGAATTCGGAGCAGATGCAGGCGCTGAGCGAGGCCATCGTGCAGTATA
AACTACAGAAGAAGTGCAAGCACTTTACAGACGAGTTCCTCTTGTCGCTTCGCCGCGACATCTGCAAGGGACGACCGGACAAGTTTGAATACCTCGGCGA
GTGGATTGCCAACATTGTCGTGGGCACCTCAGCGGCCAAGATCACAGTGCGCGGTATCGAGATCCCATCTCTTCCGCCTGCAGCTCGTCAGCGGTTCGTG
TCATACCTCATGCCGTTGGTATCAAACAGAACCGACATTGAAGTGAACATTGAGTGGCTACCCGATGATGCGGACCACATTAACGCTGCCGGTCGTCCAA
GTGTAGATCGAATGAGTGCTGGCGCATATGGCAGTGGCGATGAAGAGGACCACGGCGTTCCTCCTGAGAACTTAGAGAAGCTGCGCATCTGGATCTCCGA
CAAAAAGACACGAACCACGTCGCCGTTTGTGTGAGAGACGTAGGGGGCGTTATTTGCACGTGGTGATGTGGGAAGCAGCAGATCAGGCAGGCGACTTCAG
TCTTCGTGCCGACGATAAAGCGGGTGCATCCTAAGTCATTTATCAAGTCCTTCCTAGCGAGGATAGCACCCGCCAAAATATAGTTAGAGAGCTTCTTTTT
GTACTTCTTTTGTAACACTTATCGAGTTATAACCCCAAAATCCAATATAGCGAAAATTATTAATTCCCGAAGATCCAAGCGTGTGGCAGCAAAGAGGTCC
AGCAATAACCCTCGCAACTCGCCGACCGGACATGATGCTGGCCTCGCTGCGCTCCCAGATGGGCGCTCTGACGCTCCGCCCGGCCGCGGGCAGCGCCTTC
ATGGGACGTGTGACCCGGGCGACACTATCAACGACCGCCGTGGAGGGCGAGGCCGCTGCGTCGGATGAGGACACAGCTGCATTCCTGAGCTCCACGTCCC
CCGCGGAGCCGCGCACTGTCAAGACTGTGAAGCGTGCGATTCGCGCTAGTCCCCGCAAGTTGACGTACCTGGCCCAGCAGATTCGTGGACTTTCGGCCAA
CGAGGCCATTCTGCAGATGAAGTTCTCGCCTAAGCGCAAGGCCGAGATCTTCCAGAAGACGGTGCAAAACGCTATCAACTTGGCCGACATCAAGTACCAG
ATTGAGCCGGAGAATCTCAAGGTGGCTGAGTGCTTCGTGAACAAGGGCACCTACCTTAAGCGTCTGCGGATCATGGGCCGAGGTGCGGACTCTAGTTTTG
TTTGTTTTCAGGACGACTGTGATAACCTAACTGGTAAATTGTTGCATTTCAGGACGTTCGGGTGTGATGCACCACCCGCACACGCACCTGACCGTGATTC
TGCGTGAGTTTGACCCGTCCAAGAAGCCGTTGAACCGTCACTTGACGAAGAAACTGGCACGCGAGAACGCCACGAAGCAGTTGGAGAAGGAGGCGACTGC
AGAGGAATAGATAGAGCGGCCCACAGACGTGTGTACATCCTACAATCGAGTCGCTTGGTCGAGATGCCAGCGGAGCATGCTTGCGGGCGACATCTCCATA
AACTTAGGCGTCATGACTATAGTGACGGAATGCACCGCTATTTTTCGTACATATTTTTCGTAAACGCACTGTTCGTAAACAGATAGAAATGTTGTCCCCC
ACGGTACTACCTCATTGGGTTGACATTTCCTACCCGATTACGAAACACAGGCGCTGTACCAGTACGAAAGAGGTGATGGATGAACCACGTGGCAAAATGC
ACTTGGATTCACTATTGAGCTCAATCTCATGTTATTCTGTCTTTCACGGTACGTTTCCTTAGATATCAATCTTCTTCTCACTTTATCACTCCCTATCAAC
CCCCCAGGACTCACCCTAAGCAATTCACACAGCCAACATGAAGTGGTCGGAACAGCTCGGCGCCAAGCTTCTGACGAAGGACGGTCTTCAGGACACAGAC
TACAAGCTGGCTGGAAAGAAGGTGGTAGGCTTCTACTTCAGCGCGTTCTGGTGCCCGCCGTGCCGCCAGTTCACGCCTTTCCTCAGTACTGTGTACGACG
ATATGGTCGAGGAGCACCCGGAGTTCGAGCTCGTGTTCATCTCGTCGGACCGTGACCCGTCGCAGTACGCGGAGTACTTCAGCCAGATGCCGTTCCTGGC
TCTTCCTCTTGAGGAGCGTACGGCCAACCAGGCCATGAGCACCAAGTTCGGCGTCACGGGCATCCCCATGCTGGTGTTCGTGGATAGCGAAGGCAAGGTC
ATCACCATGGACGGCCGCAGCGTCGTGGCCAACTCGCGCGGCGACGTAGAGAAGCTGTGGGAGCAGCTTACCAAGTAAAGAGGCCACTGCGTTGTCGAGA
CGCTGTTTGGGTTGGATTTGACGGCGCGACAGTGTCTTCTTTTTCAGAGCTTTTGAGAAAGAATATGATGTTTTCCCTTTGCTATGGTGAAGTAGTACGC
TCTTGAGGGGTGTGTTGTGCTTTGGTTTGTTGCGAGCGTCGCAGACTTCTGAGCAGGGAGAGCTTTGACGCGACGGATACTGTGTCTGGATTATGAAGAT
CCTTGTGCTTAGGTGCTGACGAAGATGCGAAAGGGGTAGCTTTAGTGGCCGTGGAGAGGTCGGGATAGTGACTGATCCCTGCACCACCTCGCAAGGACAT
GACGCGGCGAGATCTGCCGGATGAAGGGTCTGGAAAGAGGCCATGCAGCACCGAGCTCGTCTGGAAATACTGGTCGCGGAGGTGCCGATGTCGACGTGCA
CGCTGAAAGGTAGACGACGCTCGTGCTTGACCAGCTTCGTGTGTTGTCTCCAGCGCAGCTAGGCGACTCCAGTTCGCGTCGGGGTCTATTAACTGCGAGA
TTCGAGCGTCAAGAGTTTGAAGCAGTAGATCCATTTCTGCAGCAGCACATGAGAAACTCATTGGATACTGCAGACGAACAAGCGTCTCGACGTCTACGCG
AAGGGCCAGTAGCAAAAGTGGCACGAGCACAGCAAGTTGTGGTCGGGGAGTGGAGCGTTGCTTGCGCTCCAACTTGGATCGGAGCATAGCGAAATTCTGC
GCGATGGAGACAAAAAGCGTGTCTTGCTCGGTGTCGGCTCGCCCCTGTTTTCTAGCTGTAGATGATGTGTGTATCACAGTGAGGAAGAGATATCGAACTG
TGCTCTGGACAAGCTCTATCATAGCAGGGCTTAGCAGAGCCCCGTATAGTACAGTCCGTGTGTCTTCGCCACCCTCAGTCAAGCCTAACGAGGCTAATGG
CAGCGTAAGGTAGAACTCATTGTGCATGTCAGTCACAGTCTCCGTGCGGGCTTCTGGTGGTACTCGGCGCTCGTCTACAGATGTGCGCCGTCGCTGTGCC
TCCCATTTGGCGATAGCACCAAGAGCAATTGGTGAGCCAGGCGTAGTATTTGATGCTGGTTCCTTTGCCTGGTTTAGCGATAACGTATCGACCGAGTCAG
CACCAATCTCTGCATAGAGCTGCAACACGTCAGGCTGAGGTAACGGTGTGGCCAACTTGAACGGCAACAGGAACTTGCGCTTCATGTCGTCGAAGGTGAA
ACAAACCGTGCCGATTTGGTAAATGTGCTGGGCCTGCTGGCCACGAATTTGCCGTCGTGGCGACAACAACGCCACCATTGGAGAAGTATTACTCGCTTCC
TCTCGCTTAATACCTGGCCTTCCTTCTAATTTGACTGGAGTTTGTCCTGCTTGAGTCAGTGCTTTCGGGTTCAAATCAATCGCCAACACGTCAGACAGGG
ATCCACGGGACTTCCAAGCGGCTGTAACAGCGCATTTCTCCATTGGAAGGTGTTGCAACACCATTGCGATGTTCTCTGGGGTGGAGCTAGCGCCAATGCC
TTGCAAGTAGCGGATGGCGAACTCGTCCTTGACTGCTTGAGTCAGTAGAGGCGGTACTGCAGTCGGTGTTTGCTGCGGTTTGAGCGGGATGGTTACATGT
AATGCCTGCACAGCAGTAGGTGCATCGGCAGTGTCTTCCTGGAAGGTGACAGCTCGTCGAGATCGAGCCGGAGGACGCATGATCAATTGTCCTATGTTGA
AGTGCTTCAAATAGGCTGTCCCTATTACCATTGGCTGGGAGTCGGCCTGATTCGATTGGTCAAAATAAAATATTAATTTGGATTTTGAACGTGTCGTCTC
CCGCCAATTCCGCACAAGCATCGTCTCGCTCAGCTAAAATGGCCAAGACACCGCGCCCCATGTATGATGAAGACCCAGACGCCCTGTACCGCGGCGCTCC
TACGCGTGTACCTAGAGTGCGTGCGATCTCGTCCACTGACCGCCTACTGAAGCCGACGAAGGCGTCGCTGGCCGGCTCCAGGAAGAAAGTGCTGACCGGC
AAGGATAAGGAATTGGCAGAGGCGCGCGAGATGGCGCGTAAGCGTCGGCGTCTAACGCGCGTGGCAAAGGAAAACGGACGACTGACGATCCCGCAGTCCC
CGAAATTCCACAAGCTCAAGAATTCTGCGCCTCGCTCCCGCGCCGACATGTTGACGCGGACGTCTCGCGAGCTGCTGGAGATCGCGGCCATCCGCAAGCG
AGTTCAGGCCCAGAAGCGCAAGACGAAGAAGTATCATGACGCTACAACACACGGCACGGCCCCAGGTAAGAGTGATCAGTTCTCAAAAGCTCTTTCAGCA
AGTGGGGGCGTCGGGGTCCCGGCTGTTCGACGTCCGAAACTCACGACGCCTGTGGGCTTCGAGCTTGAAATTGACAAGCGCGCGGCGGTGGCAGTGACTC
GTAAGAGTCTTAAAAGGAAAAGTGTGGCGGTAACGCAGCATGTAGTGATGGAGGAGGCGCTGACGGAAGAAGCTGCAAATGCTGAGGAGGAGAGCGAGCC
ACCACTCAAGCAGCGCCGAAAGTCGGCTGCAGCACGAGTTTGAAATGGACGAAGTGACTGCGCTGAGAGGCCAAGCAGGTTGTCGTGATCTGCTGTCTCT
GGTGAACTAATGATTTAATGCCATTTTATAGCTAACCGTGGTTGACTCAATGGCTGCTAGCCAAGATGACACTGTATTTCGCAGATCAACGGCCCCAGGC
ATCCGACAAGCGATACTTGGCCTACAGTAGCTAAAGCTAGGGTGTACTCTCGCGGAGAGCAACCTCTGAAGTTGAGACAAAGGAAAGTCGGCCGCTGCGA
CGTGACAAACCTCGCCCGTGATCTGGTCTCAAATTGACGTGCATTGCGTGAGCGCTCCGAATCCGAATGGTTTGCCTCTGGCAGACGGCTCAGATGGACA
GCCCACCGGTCGGGAAGTGGCAGCGACGGCCGACCCGCACGTTTTGAAGTCTTAGAGCTCGCTCAGCAGTGCTGATTCAGTGCCGAACCTCCCCGAACTT
GACCAGCGGGCTTCGCCCGTCCCTCATGGTATTGTAACTTCTTCAAACGGAAGGGATGCAATGCTAGTCTCGCATCACCAAAGCGTTTCTGCCTGCGAGA
CACAAGGCACAATGCCATTGTGAGCACTACCGGTAGGGTCAGTCCTTTGCCGCTACTGTGCAGCCCACACTTCGTTACAGACTGTCATTCACAGCACGAC
CTTCAACATGTATGCCAGCTCCGACTACATCTCGCGCGCGGCCTGCACCTGCCTCCTTGAAACTATGAGACGGCCTTGTAGCTCTTTCGCCTTGGTCTCC
GCACTCTACGGCTGTCGGCGAAGGCAGATCTTGTCGCACGCAGCCAAGATCCCGACCGCGACGTCCGACCGCAGCCAGCATCGCACCAGCGACGTCAAGC
GGCACCAGTGCCGCTACGTTTTAGCGTCGCCTAGCGGATACTACAAATTTTTGTGTTGGCCCACAAAAAAAGATTTTTGGTCCCGCGGTGATGGGCACTT
CGCGCGTGAAGACACTGCGAACGCTGGTGCTCAAAGTATTTCGAATTATACACACATCAAGTCAGCAGCCCAACTGCCGACGAACGCGGACGAAAGTTCG
TTCGGCGAACTCATCCCGAAGGGCAAGTTTCCAAGTGCGAGTCCAGCGCACTGAAACTCGGAGTAAACGCCGTTGAAGCGAGTGTTTGCTCCAAGTTGAC
TGCAAACTTGCTAACTTAGCAGTGCTAAGAGCTTTTTCTTTTCTGCACGTGGCGATCTTGCAAGCCAACTTGAGAGTTGCATCAATCCGATCCGAGCTCG
CAGCTAGCCCACCCAAGCAGGAGTACAGGAATCCACTTAAAAATGTAAAGCTACCTGATGAGAACGTCGGCATGTTCAGCCGAGTTTTCCTTGGAAGAGC
ACCGCGAGCGTCGCAGAACGCGGCCGCGCTTCCCAAAAGTGGTGTTGCGGCCTCATCACGCCGTGGAAAGATGAAGCTCGCATGCACGCCTCCTGGTGGA
AGCGACGACGGTGTCTCATACACAACCAGCTCACTGAGCGGAGTCAGCATCAAGCCGATGCCCGCTTGATGCAGTCCATGCAACTCTGCTGGACTAAAAC
ATGCGAGCCCGGCGCAAGCGAAAGGAGGAAAAAGAAGAGGCTGCGAAAGGAAGCCGGCCGAAGCGAGCGTCATGTTCGCAGGCCGAGTACTGAACTGGGA
CGACGCCAGTAGTGTGTGAATTCGCAGCAGTGCCGTTGGTCAAGCGCTGTTAAAAACAGATTCGCAGTGCAGTACAGTCAACTTCAACGCCTGCGACCTT
CAGCGCGGAGACCGATCTTTTTCTGGATCGCAGCACCGCCAGGAAGCAACACGCTGCACTCTGCTACAGCATCTTGCGACACGCACATGCTTGAACAGGG
GATAGCGAAGTTATTTATTTTGTTTTCCTAACACAAAATGTGCCGAGATTTTGGTGTGACGTATGAAGGCACCTGGTTTCATTCTCGATCGGAGCTAGTC
TAGTTTTCGTCGAGGATTAGTTAGGCTGTGGTCATCAACAGGTAAGATTCTTGCATTTCCAAGGCTTCCGCCGCCGCAAGTCGGCGCAGCCCTCGGGCTG
AGAGACGGCATATGCGATAAGACATCGGGTCGCCTGAAATGCTGCTGTCTGTGCGATTAGCTAGGCTGTTCCAACCGATAGCAATCACTAGGAGCCAAGC
TTTCCAGCATCTGTGCTGAAGTGGCGAAGAGATATGGAGCTATCCATACGGCGAGGAGCCGCAAGTGCCTCTGCAGTAGAGGTTTCCAATGTAGTGATCT
CAGAGAAACAGGCGAGTGCGAGGAACGTCGACGCGAAAGTATAGCTGCCGGGACCTTTACGTCACCGCGGCCGTGATGCTGCATCTTGTTCATACTTCGG
TTACTGTTGCAGCGGAGAACGCGCCGAAATGCATTTCGCGTCGAGGTGGCCCCGTATGCGTTTTGCCGTTGTGAGCTTTTGGTGATACATGTACAACCGA
CAGCAGTGCTTGATTAAATGAAATTGCAAAATATTGGCAAATTAGCACGCCAAGCAGTAGCAGCAGCAGCATCTTTCTGACCACCGTTCCTGGATAGCCT
GAGGCAAGCCGCAACCGGCCAGCGCGTTTTTGTATGTCGCCTGGTGCCGCGACTACTGCGCGCCGCAGCTTGGAGTAAAAGCTGTTTTCAGCATTCAAGT
CGCGCTCACTGCGTTGTGTTGACCATCAGCCGGGGAAGCATGCGGATATGTCAGTGCCCCCGCCTGCTGGCGGCAGTTCTCACTCCACGCCAGCGTTCGG
AGCGAATTCTTTATGCGCTCGTAAATTACCGTCGATAATTTTAGCGGGCATTTCCATCTGAGATACCGCAGCGTACTGTACCGGAACTGAACAGACGAGC
CGGCGGGATACCCAGCTGCCATTGGTCAATCTTTTCGCTGAGAACCGCTCTGAGCCATAAGTTACCCCTACCCGCTTTCGCATTGCCCATCCCCCTTTTT
CGCCCGGCTAGGGCCACCTTCGTGTCAAAGGCGAAGCCAAGCTAAAAAAGTGACCAGCGGCCTCCGCCTAATCACATCACTCACTCGGCTCCATTTCCGA
TTTTTGCTTGAGCCGCGCACTCCGCAGCACCAACACAGCAACCATAGCAACTCCAACCGCCATAATGATGATGCCTAACAGCACCCACGGAGGCCTCGTC
GTCTCTCCAGCGCCCTCGACGCCGATCACGCGCGGACTCTGGTCTGAGCAGGAGCACGAGCAGTTCCTGCACGCCATGAAGATGTTCCCGACGGGCCCGT
GGCGCTCCATTGCCGCTTTCATCGGCACGCGTTCTATCAAGCAGGTACAGACGCACGCGCAGAAGTACCAGCAGAAGATCAACCGCCGACGACGTGGTCT
GCGCAAACAGAAGAAGAAATTCGTTCGCCCCGAGCACCGCGTAGACGCCCATGCCACCGGTTGCATCCAGCGCGTGAAGAACTATACAGTGCAGGGATCG
CCGCGATCTCCGTCGGCTTTTCCCCTCAGCGCCATGTCCCCAATGAGCGGTGGCTTCGGACAGCTACTGACGGGCGGTTGCAGCCCTGTAGCAAGCGATG
CCGGCAGCAGTACCAGCAGCTTTTCCGGTTTAGACTTGGATGTCGACATGGATTCGCTGCTGTGCGAGCTGGAACCGCTGCCGTACACGCCCGGAGTGTC
GTTCGAAGACGTCCTGGTCGATGACGCTTACCGACGAGACGTGCAAGAATCTGTCGACCTGCTTCTTGCCTAATTTATTGCGCCTCCGCGGCAATCCGTA
GTAACACCTCAAGAGAAGTCCAGCAAAGACCCGAGTGCAACAAGATAATATCATTTATACGCTTTATCTTCCTTTGTCTTCATTTGTGCGATCTGTGCGC
TGCCCACTAATGCATCTACTCACTGAGGTGAGCTCTCTCGGTGGAAGGAAGCATGATCAAAGACTGCGTACTTATGAAGCGGTAGTTTGGAACAGTTTTA
CATCGACAACTGGAGTTGTTTATCGATGTCGTGAGTCTCTTCGCTCAGCACAATTGAAACAGCGTCGAGACTTTCGACTCGAGAGCGAAGTGCTTGGGTC
TCGAGCCTTGAGATCAACCACAAGGGCCGAGTCGAGCTGCTCGACATGACAACTCGTGCAAATCGTCGCAGCTGACGGTAAGAAGATTTTTTGTGATTTG
GGATATTGTGGAGACCAAAATATTGAATATTTTGGATCAGATTGCAATTTGCAAAATGGCTATTCAACCAACCTGCCGCCGACTGTAGTCTGTAGTCTTT
GCTTAAAACCCTTTAGCTGCCAAATACATGTACTCAGAATTATCGTGTGCGGCCAGATCTGTGCCGCTTGCGAGTACACCGACAACTCCATGTGCTCCAG
ACTGGAGCCTCCAGTTGACGATGTTTCCATTGCCGTCCCGTTGTTCGTTCCGTATTTTCCATAATAACGCACACCCAATGCCACAGAGTGCCCACCAAAT
GCTCTTGAATGCTGCCTCAAAATCTGAGGTTGATAAATAGTCCTGGAAAGCTTTCTGATCTTTGGTCGTTACTTCATACCCCAGCCAGTGTCTATCCTTA
AAGCTTGAGCTTGCCACATGATGCGTGTGGTCGTTATCTTGCTGTCTTGACAGCTACTATCGTCTTGGGGTGCTAAGCTGCCTAGCCTAGGCATTGTGTT
TTACATGTTCTCATGCTCTGTGAGTCATGCCTGACTGAATCCGAAACGAAATTTAATCGTTGTCAACATAAATTAGTCAACTGCTGCGTGTCCATGTAGC
GGAGCACTGTCGGTACATTCCTGATAACGCCTAGAGGGCGGACTATCACCAACCTCATCAGACACCGATCGTCTGCACATTTGAACCTCTCTCACCGATG
GAGCCTGGAATTCAAGTGCAGTATTGAAAGCCAATTCGGTTCGTTTGTAAATGCAACGCGCTTCAGTTTCTTATAGCCACCGTGTGTTCATGTAATATGC
TTAGATTTGATCGCACGCAAGGGTAAGAGTTGATACATGTGCATGTAGCTCGTACGGACTTGCAGTAAGGCTCATCCAAGCGAAGAGAAGGCAGCGACCT
GACAAGGAGACTACGCTGCGAACAAACCTGCCAAAACGAATGCGCCACGCCGCACAACATACGTGTGCTGTGTGGAATGTCTGCACCAATGCAGCACGTG
TGTACATGTGCATGTATACATGTATATCATGTACCGGTAAGTACGAGTGTATCGAACAGAAACTTTGAATCTGTAGCAGCTTCAACGCAGCAGCAATTGC
GGCGCTGCCATTCATTGCTGTCTCCAGTGGAGACTCTCCAGAGGATATGAATTACAGGCGTGCAGCAATTCAATTCGAGGCGATTGGATGCTCTCGTGCA
CCGAGAGGGTAGCAAGTGATCATCGTCAGGCAGGAAAGTCAACTTTGGTAAGGCGGAGCGCGGGCAAGCTCGGTTATTTTGTAATGTACCGCCTTGCCGA
AGTCCCAACTGGAAAGTATCCTTCTACATGTATAATAATGCAACGTATGCAGTCATTCTTCTCCGTACCGGTATAATACATGTGCATGTAGTGCCGTCGA
GACTGTTGCCACACTATAATAGCTTTGCAAGGAATCATGCGACATGGCAATGCCACGCAACGCGCGTCGACGTTGGCTCGTACGGCGCCCAATCAGAAGC
TTTTGCCGTAAGCGAAAAGATTGGATGCAACCAAGATCATCACACTTTTGTAGATCGAATGGGCGATGGCTGTCGGCAAGACCGTCTTGGCTTCGCGTCC
TCAATTGGTGGCGCCAGGAGCATACCGGCAGCGGCGCTATTAATGTACCCCAGCCGGCGCTATTAATGCATTGTGCCACAGCGCGAAATTGCACTGAAGT
TCTTCATCCAGACGACCTTGAAGGCACTTGGCACAGTGGTTTTTCTCTGCGCCTCGTAGCGCCGTGACAGTGGTGGCAGTGCCACTGGCACTTCATTGCG
CCAACGAGCGAACTTACTGGCAAGTGAACGCCTATGGTACAAGCTGGACCGCGTACCGTACGCCGAGCCGCAACGCAGGGTGTCATTCACGTACGCCGTG
TACGTGAATGACACCCTGCGTTGCGGATAAAAAACACCATTGTGCAAGGTGGAGTGGAGGGTAGTAGTAGCTCGAACTGTTAGCTGTCCGGTTGAGCTGC
TTCACAAGGCAGAAGCCTCCATAGATAAAGCTTGTATTGCAAGGGGTCTTTGTTATAAATATATGAAGCTAACCGCATGAGAGGAGCGCTTGGCCACGGA
TACCTCACCAAAAATGACGGGTCTATCCCATCGATACTGCACTAACAGCAACAGAGCTGCAAGAATTATATCGACAGGTAGTCGATCAAGAAGTCTAATG
ACTCGCTCACGGTGGGGATGTGAACGGGGTCAAGGTCGATGTCATCGCCAAAGTCCAGGAACGGCAACGGCAAGAAATCGTCGGTCTTCATCTCCACATC
CGTGCCGCGCGGGCTGCTGTGAGCCTCAACAGGCTCCAGCTTCACGCCCATGTTCTTCTTTTGCAACGGCTCCAGCTTGACACCATTGGCTCGCGAAGAC
GACTTCCTACTTGCAGCGACCAACTTCTCGGCGGCGCAGTCCACCAACTTGCACAGCTCCATCGTGTCATCATCGATACGGTGCTCAGGGCGCACCAGTT
TCTTCTTCGATTTGCGTAAGCCGCGTAGTCGGCGCGACACTTTCTCCTGATACTTCTGCGCGTGAGTCTGCACTTGCCTCACGGAGCGCGTGGCGATATG
ATCGGCGATGGTCTTCCACGGTCCCTTTGGGTACAGCTTCATAGCCTCCAGAAAGCGGTCATGCTCCTCCTGGGACCAAATGCCCTTGGACGTTGGCGAA
ATCGGCTTGGCCTTGGCCTTGGTGGCCGAAATTGGCGAACTCGATCCAGTGGCAATCATTTGCATAACGAAATAGACTGGATACGAGCAGGACACTGCAG
ACGTGACAAAATACTTGCAGACGCGTGGGCTTGGAGGCTTCGCTCTGTCGCTTGCGGACTTGCTCGCTCGATGTGAGGCGAATTCGGGAATGACAGCACT
GGCGATCCGTTCAAGCTCGAGTTTGATGCAACCACGTTGGAGGTCGGCACGTCCTATCAATGGCGGTAGAAGCTCTCTGGTCAGTAAACAGTCCCTTTGA
GGCCCGGCTCTGGGACCTACCGACATTCGTACTTATCGCAAGAGTTGAGTGCGCTGAGCAGATCACCGGTGATCTGTTGTCAAACTGCGCTGTCCGCTCG
CCGCCAGTAGCGGCCTGCCACCATCGCTTTCCGCGCAGACAGCAGCACTCTGTCGTGGAAGATAGTTACCGCCACGTGCTGAAGTCTTGGCGGGCCAAAG
TGTGCATGTACTGGCCCGTTGGCGAAAATGAGAGGATCCCTAGAAAAGGCAATAGGACGGACAAGCTGACCTGCAACGATCGCTGGCGACGTCGCCACTG
GATTAACTCTGTGGAGTTACACATGCAATCAAACTGCCTGACTTTTGGGTTGTTGCCGTATCCAGCGCAACGGGGATGGCGACCGATGATGCCCGCACGC
GGGTTGAAGATAGAGAGTCTTCAAGAGGTGAAGTTCGCACTGCGAACAGCGGCCAAGTGGCGATTTTCTCGCAGAGCATGTCGCGGAGGTCGACTTGGGC
TCATAATCGTTAGTTGTCTCCACGGCGCAGCGGCCACTGGCCGGTGCCGACGATGAGCCTTCCATCTTAACAAGGTTCTTACCGCGGGCGAACTCCGCCA
TGAACTTCATGATGAAGCTCCAAATTGCCACAGCCGACTGTGCGTCAAAGCGTGCGGATACCGATTGTGGAGATGGGGGATCTGCACAGCGGCGGGGCTT
CTTCGATTATTTCGGGCGCATCATATCTACACTTTTGGGCAAATTCCGATGTTGGCTAGTCTATGCCACTTACAAAGATTAAGTCACCTATGACGCCGGT
ACAGTACATGTACTCGGGAGCTCTTCGTTGCTGTTTTTATGAGCAGGATGACAGCTTCAACACCCGGCACCGCGACGACTGGAACGGACGACCCTGTCGC
CGCAGAGTCGGCGAATGCACAGAGATTCTCGTGGCAGTGTTTCTTGAGAGCACTGAATCCTGCGCCTCCTCCGCTGTATTGATCCTGGCTGGTGGCACAA
CCTCTATGGAGCCCAGAACAGGGGTATTTTGGGCTCGCACCAGCGTCCATGCACTTCTGAAGATTTTCCTCGCGTGAAACGCAAATTGGACGCCTACGAC
AAAACACGGGGCTGCCCGCTGCCAGTGACACTGGGTACTACCCAGTGTAGTGTCCAGCGATAAATTGCTCACTTATTGAGCGTTTATTACAAAGAACTGT
CATGCATCGATGGTATATAGCGAGTCGCAAGACACTTTAGGCACGAGGCGGTGTGGCCTTTGTCTACTTCACTACATTGGCCGTTAGCGGACTCGTCGCA
TTCTCTCCAAGCAATTGCCAGAGGCCAGTTGCCATACCGCTTGTCACAGATACCACTGCTGTGTAATTTTGACTGCAAGCACTGTTTGCCAAACAGGCAC
CGCGAGATCGTCGAAAACTTTTCGAGCGGAATCTTTACATGAAGACTGTCCGCCTCCTTTTCGCGTCGACCAGACTCTGTGTGGCAGGGCTCCTTGTCGG
GCCTGGGCCGACTGCCAGTTACTGACTTCCGAAGGTATCTGTGGGCTGGATTCGTGCCAGGAAACGCTGGAAGTTAGCTTGGCCGGCTGTGATCGCGATC
AAGAAGCAACCCGAGTGGTTAAGGCAGCGTCTCTGACTGGCCGACACGCAGGCACCATCAACCCAGACTCGACGTGCAGTCTCCAGCAAAATCGATTGCG
TCGACGTCGGACTTGCACGCAACACTCAACGTTAAGCTTGGCGTTAAAGCGCCAAAGTTGACAGTCATACTTTTGTAAAAAGCGCCTCAGCGGTATCTGC
TGTTTGCTAAACGCGTGGCAATGCACGGCGATCCAAGCAGCAGAGTGAACCGCACAACCCTGCAGGAGCGAATGGCACACATCCGGCGATCTCTCCGACG
ATCCGGATGTCGGTAAAGTGTCGGTAGGAGTGGCAGCTGCGCAATCTGGAGAAGAATCTCCTGCCGACATGTCGCTACCTACATGCACATTCGCTCCAAA
ACTGGAAAGCGTGATCAGCGTGATTCCCTTTCCGGCACGGGGCGAAATTTCCGACCCGCGCAGACCAACCAGCCCAAACCTGGAAACCAGTGCCGTGACG
GTGTCGGGAACGATAAGTTTACTTTCTGTTACATCTACTGTACACAGAATCCCGGGCTTCTACCCGGCGACATGAATAGTGAAAACGAATCCGCTGCAAT
GCTTGCTATTCACGACAACAGTAGCGAATGCCATCGCTCAAATGCTACGGTAGCAATGTTTGCCAGTGATCCAACAAGTACCTACCGGTATGGCAATAGC
TGCCGAACAGCGAG