Description :
From Genome Similarity Track
Location :
Scaffold_40:960645- 961935
Sequence
1290 bases(100 bases per row)
TTACAGGCGTAGGTGGGTACATAGGAGGCATCTCAATCGGATCCCAACCAGGCGGCAACATCGGAGCAAACGGATTTCGGAACGAGTTGGTTCGGGACGT
TCCATACGTTCCTCCCCCATCGTTCGTTCTAGGCGTAGGAGCGGACACGTTATCGTACGCGTAGACAGGAGACATAGGTCTGCTCGTCCTAGGCGCAGTG
GGTGACTGGTACACAGCCCTACCACCTCCAGGACTACGCATTTCACTCCTCGGCGACTCTAGCAGTCGATCCATCTCGGCGCTCGAGTACACCGGCGGCG
TATTCGCCATTCTTGGTTCTTGATCCGCCAGCGGAATGCGTGGCGTTCCCACTGACCCACTCGACGCCGCAATCTGTTGCATCGCCTGACCGATGGTGTT
GACTATCAAAGCTTGTAGTGCCGGGTCTACAGTGGTCGTTCCACCACTCACAGAATTCGTTCCGTCACTAGCGGAAGCCGTTCCAGCACTAGTAGGAAGT
CGTTCCACGACTAGCAGGACGCCGTTCCCGTAGCTTGCAGACGTCGTCTCACGACTTGCCGTAGGAGTATAAGCTCGCGAAGTCGCCCTCGGCGCACCGT
AACGTTCCACGTCGCTCTGCTGCTCAGCGCGAGAATTAACCGTACTCCGAACGTTCGACCATGACGCAGGAGCGTCGTTCCCATATCCTCTACGAGGATC
CTCCCCACGCGAATACTCAGTCGACGCGGCAGGGGTCGCCTCGCGACTCGTTTCTTCCACGGGATCCAGAGACGGTCGTGACGGATCCAGCGAGAACGGT
ACCCCTCTTCTCGTTCCAGAACTCGTCGTGTCGGTCTCACGCGTCTCCCTAGCCCGGGCCTGCTCCTCTCTAGGAGTCGGTCGATCAGCTAGAGTCCTAA
AGAACTCTTGAAAGCTAGCCCTGCCCTGAGGCGTTCCCAGCATCGTCACGAACATCCTTCGATTCTCCTCAGCTCGAGGTGACGTGCCAAACAGGCCATC
GTCTTCATCCAGGTCGACTCGTTCCTCGTGACCTCCGGCAGCTCGTTCCGCCTGACCTTCAGCCGCTTCCCCTGTCTCACCTTGAGTCCTTGGCTCAGCT
TCGTCGCCTTCACCTTCCGTGGCCGGAGCGTCAGCTACTTGCTCCTCATCTGCTTAAGCCAGGATCCGCGTGAGACGAAGCTCCTCATCCTCGATAGGAT
CGTTCCAATTTTGGAAGCTCATACCGTTCCCGCTTCCCTTTTCCTTCGCCTTAGTGCTTCGGTACTAAGGATCTCCAAGCGGCTCTCTCC