Description :
From Genome Similarity Track
Location :
Scaffold_138:9606- 12656
Sequence
3050 bases(100 bases per row)
CCAGTCTACGAGACCGCCCGCGAATATGAAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACCGAGGAATTCGCCACGAGATTGATCTCG
TGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCA
TGTGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGTGTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGCCTTCAACAAGCTAAACGAC
GCTACCATCCCTGCCCAGACGCCGATTCCGCGGAAGGACATGGTGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCGCCATCGACTTGACCGATGGGT
TCTACCAAATCCTCATGAGGCTGAGCGATATACCGCTCACAGCGGTAAGAACTCCCAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCGCAAGGGTTGAA
GAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGACTTCGCACCGAGTTATTTCGATGACATCTTCGTACACAGTCGC
GCTGAGGGAGGCCTCAGCGCGCTTGAAGTTCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTGTATGCCAACTTGAAGAAGT
GTATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAAAGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCC
TACGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCACACGTACACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCT
TCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGACGAGGCCCCAATCCTCGCGC
TCCCGGATGACTCGAGGCCTTTTCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGGGCTGATGCAATTCGATGAAGAAGATCGAGAGCGTGT
CGTAAGCTACCATTCTAGGCAGATGAAGCCGGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGGTGCGCTACGCTCTGATCTAGTTCAGA
GTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGATCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTCTCCCAGCGGATGGCCCGCT
GGCTTTCGTTCTTCTCTGAGTACAACTTCGTTGTCCACTACAAACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGACCC
ACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCCATGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGTCTCCCCG
GTAATGCCACTTCGCGACGAGATCCGAGCTGCTTACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGACACACTGG
GAGCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTCTCGAGGACGAGCTGCTGGCGTACAGCATCGACAACTTCGATGCCCCACGTGTCGT
TGTCCCTAACGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCTGTG
TCACGCGACTTTTATTGGCCACACCTGTACAAATGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGCAGG
CTCCCTTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGATCAGGTGT
CTTGGTATTCGTAGACCGCTTCAGCAAGATGGTTCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACTTCCTTGATGCCGTC
TTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTTGAGCTACTGGGCTCGAAGC
TAATGATGTCCACAGCAGCCCATCCGGAAACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTC
CAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTTCGCTCTGAACAACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCTTCGTTAACAACGCACGACAC
CCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACTCTGGGTGGGGAAGAAGCTGCCGACAAGCCGTCTACTCCATCTG
CGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACGTGTATATACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGGTCAACGC
AGTGACACGCTCCGCATCGAGCTCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTTCGTACTA
CAGCGCCAAGCGGTCACCCGCTATGTTCGTGACGCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGATAAGGCTGGCCGCAAGAACACAGCCA
CGTTTACGACAGGCGAACGAGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGTCGCGCTTTATTGG
GCCGTTTACGGTGATCAAGACCATTGGTGACGCTTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGACGTTCTACGTCGGACGTTTAAAAAAA
ATACCATCCGTCCGAGATCCCGGACGCTGATTTGTCCTCGAGTGACGCGG