Description :
From Genome Similarity Track
Location :
Scaffold_210:9605- 12348
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_210-snap-gene-0.21Flagellar radial spoke protein

Sequence
2743 bases(100 bases per row)
TGACCAAGCGCGTATTGTTGCATTGAACGCTAGTTACTTTTTGCGAAACGGCGGTCACTTCGTAATTTCCATCAAGGCGAGTTGTATCGATTCTACTGCA
CCAGCTGAGGCGGTCTTCGCCCGTGAAGNNNNNNNNNNNNAGCTGCAGCAAGAACAATTCAAACCTGCGGAACAACTCACCTTGGAGCCTTACGAACGTG
ATCANNNNNNNNNNNNNNNNNNNNNNNTGGTTGTTGGATCGTACCGCGCCCCGAAGAAGGACAAGAAGTAAACCAGTTTTGCTTTGTCTTGTCCTTGCTT
GCAAACAAAACGGGAGCCATATCAATAGAAAAAACGAATGCGTGTCTCTTGCATGTGGCACAAAAGCAGGGCCTTGGACGTCGCGAGTCGACTGATCGGC
CGCGCGAGTGCATGTGGCCCGTAATTGCACCCAGTGATCTAATTTATGCCCACTTGACGCCTCTAACCGCTTATCTTCCTCGTCTCTTGTAGGTCCTCGC
CCACAATTCCCCCTCCCACCCACCAAGTAGCGTAGTAGTCGAGTCAACTAATCCATCGTGTGCGTGGGTCTGTGCTTGTTTCCAGCCTCGACTCTTTCTC
TCTCGTTGGTCAATTTTCTCGATGATTAAAAACTATGCGTCGGGCGGACTGAACAAAAACACCATCCCGCAGAAATGTTGGTGGTGCCGTGCTGAGAAGA
CGTCTTGAGCCCTCCCACGGGAGGTGCATGAGAGAAAAATGGCACGAGAGAGAGAGAGGAGAAAGTGGATGGGTCCATACAAAAGGCACGCGCTGTCTGA
CGGTCGTAGTTGATAGCTTGAAATGTTTGTTTTCCACGTGGGCGGGGATCCGTCTTCTTTTTTCTCTTAGTCTTCACATCCAAATAGCAAAAATATATAA
TACGCACTTGTAGCATTTATTCAATCTTCAGTTGATGTTGTTTTTTTCAATCGTGAATGTGGGAAGCTGGTGCAGAAATACCTCGCCGTTGGGTTGGTTT
CCACGAATAGCTTCACTCTTGTGCTGCCAACTTCAGGGTCAGTCTTCAACATCAACACATTCTTCACCTCGTGATCTTGAATTGCTGCAATGCATCGCGT
CAGGTACTTACCCATAGCCCTTGTGCATGTTTGCTTGTGATCATGAATGATGGCATTGAAAACCATTCTCTGCAGTGACCAGCTTCGTGATCGACACCCA
TACCTGGATCTGCCGTTCCAAGAGTCGTACAATTCAAAAGAGGTAACCTGCAGACAGCAAGCACATTGAGGCCGTTTACCCACCATTCAGATCAAACTAA
TGAAAAGTATGCTTCTGTCGTCTTCCATGTGACGCTCATCGAAGGTCTCTCGAGCGTTTGGCGCGCGAGCCGTGCCCAAGTATGCTGAGCTGCTGGTAAT
GGACGATCTCAGCGACGAAGACCGTGTCAAGACGCTCCAGGAGCTCTTCGAACTCCTGAGCAACCAGGTCTGAAAGCCTCGTACCGAGGTTTCCCTTGCA
CATGCTATAGACACTTGACGTGTGCGCTTGGAAATTGGATTTTCAGGAAACCAAATGCACGGCTGGAACTCACGAGATCCTGTTTTCCTGCGCTGATCTG
GGGGAGACGTCTCGATCGAGCGCTGTGCGCATGCACGCCGCACTCGTGATCTCAGCGCTCGTCCTCTACGAAAATGTGCGGCTTTGTGCTTGGTTAGTCC
TTCATTTTCTGGATCTGATCTCGATTTTTTCTTCTACGTCGCAGGACAAACCTGATGAACTGGGCACGGAGACCATGTTGCGCGCTGCGATCACGCTGTT
GAGCGACGTTGACGAGAGCGTTGTTGCAGCGGCATGTACGATTTTCCGCAGCGTGTCGCGGTCCAACCAGGGCGCGTTGCTGCTCNNNNNNNNNNNNNNN
NNNNNNNNNCGTCTAGTGCTACGGCCATCGAGTCTCTCATGGCCATGGTCACGCGGCAGCCTGTAAAGATGATCGCCGAACCAATTCTAAGCGAGCTTCT
TGCCGTGCTCGCCAACATTACGCGCGTGTTTCAAGGNNNNNNNNNNNNNNNNGTGCTGGACATCCTGAAACACGCACGACTGTACCCATCGGAGGTGCTT
CTCCATGCCGTGCTCGTAATCAGCAACTTTGCGACCCACGACCAGGGCAAACGCGACGCGATCGCCAAGAACGCGGTCGAGATCTGCCTCAACGTGCTCA
CGCGAGTGCTCACGCCGTCGCAGGGCATCAAATGCGAGACCGAAGCCGCACAGATCGAGCTCACACGATGTGTCGTCGGCGCGATCATGGGACTCTCGAC
CTACGAGGACGCCAAGCCGCGGGTTCTTGAGTTTGGTGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATCCACA
CCCGTCGATCCAGCAAAGTGCTGCGATAGCCGTGAATTCCGTGTGCGAGTCACCGCTTGGCGCTGCGAGCTTTACGCGGAAGCTGCTCGCGGACAAAGTG
CTGTTGGTACGTGTGCTAGGCGTGCAGGCGATCTCAGCACTACACCCGAGTTTGTCGGGCAAAGACGAGGACGACAAAGTCTTGGCTTTGGACGTGCTCG
TGGATCTGCTATCTGACAATGGAGCCACAGCGGCAGCAGCAGCCCATAAAGTCGTCCAGTGTCTCGATATGTTGGATACGCTCGTGGAGCTCGTGCTTGA
CCCGCTACGCGAGATCCACCAGCGCGCGCTGCTCGTGCTGCAG