Description :
From Genome Similarity Track
Location :
Scaffold_664:9604- 13763
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.8Calmodulin-binding transcription activator
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.9Calmodulin-binding transcription activator
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.18Conserved gene of unknown function

Sequence
4159 bases(100 bases per row)
TCTTGAAGGGCGGCCAACAAGCTTACGCGCAGCGAGCGGCCGCCGCCCGAGCATGCCTGATGCGATCCAAGCGCGCGCCGCCGCCCTGAGACTCGAGGCG
ACGCGGAGATGGCTAGTCAAAGACGAGCTGATTTTCCTGCTGCTGCACTACAAGCTCTCGGGGGTTCCGATTCTGCGGACGCTGCGTGCGCGGCCACCGA
GTACGCGATATCGTCGGCACGCGCTGCACATTGAGACGCAACGGGACGACTAACAAGGATGAGTTGTGTCGTTATTGGTCGACGCAGGCGGGAGCTTGAT
GGTGTACGACACGCAGGCGGTTCCAGAGTACAAGAAGGACGGCTGGCGGTGGCAGAAGCGCAAAGACAAAAGCGGACGGGTGAGCACTTGTGATCCCGAG
GCAGCCTCGTGCGGATGCTGATGGAATGGCGATTTTTTTTCTTTGCTTCGGAAAGGTGCGAGAAGATCGAGCGAAACTGGTGATCAACCGGGCAGTGATC
ATCCTCGGGTCGTACGTCCACTCGGCTGATACAGCGGTACACTTGTCGATTGTACTGTAACTCGAGAGCGCAGACAATGCCGAGCTGACTCGGTGCTTGC
TTTGCACAGACTTTCCATCGGCGGAGCTACTATCTGCGCGACTCGAACCAGAACATCGTGCTAGTGCACTACTTTGACGAGGTCCACAAGCAGCAGCTTG
GAGGACACCCATCATGCGCATTAGCTCCACCACTACCACACTTCCCTGAAGAGATCGACGTTTCAAAAGTCTCTTCACTGCCGGGTGTCGATGCTGCGGT
GCAATCACAAGAAGAATCTGTCGATGCTGTCATGAAAAGTACGCCACTGTTTTGCTCTCCTTTCCGGCGTTATGACATACTGACGCATGCTCTTGTGTAC
GCTGATGCCAAACTGTCAGAGTGTTTCGCCTTGGACTATTCGCACACCGCCACCGGCCTGACGCAGCAGGTTCCGACGAGCTCGTCCGGCGATCAAGATA
TTGACATGATAATGAAGGACGGGATCACGCCCGACTTTGTGGACGACGTGCTGTACAACGACGCTCCAGTCTCGTCGACTGAGCTGGTTTTAGCCGACAA
ACGCGCGAACATTTCGGACTTTTCGCCAGATTGGGACTTTGCCGAGGGTGGCGCAAAGGTGCTAATTTGCCTGACGTCCTCGTTGCCGGTACCGAATGGC
TGCAACGCATCGTGGCCGCTGTTTGTTCAGTTTGGACGGAGTCGAACGCCTGCAGAGCAACTGTCCGAGACGGTGCTTCGATGTACAGGTGCGCAGCTGC
TTTATTGTCGTTATCCTTGTCGAATGCTAAGCGGAAGCTTTTGGCAGCCCCAAAATCGACGGCGGCAGGCGTTGTCGACATTTTCGTTTGTCGCTGCGAA
GACCTTCAGGCGAACGATCTCATTATGCTGACCGAGGCAAAGCGTTTCGTGTACCGAAGTCACGAAGAGTCGTCGCCGGTACAAGCACCAGCGTCGGAAC
CGCGCTCGACAGATTACAAGGACCAGCCATTGTTACCTTTATCAGCAACTGTCGGTGGTGCAAAACGCGGTCGCTCTCCCAATGGCTTCGCGCTGCTCGC
GCAGAGGAATCGGACGGCTGACAAGACTGCTTATGGTGGCTTCATGGCAAATCTATCGTCCTACGTGGAGGCAGGCTGTACGTATCAACGATGGCTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTCGTGTTGACAGTCACTGACGGGGTGGGTATTGTTGTCAGTGGATGAACGGCAGTGCAAGATCCGCGTCGTCGAGCG
TCTGTCCGAGTTCCACCAAGCCATTTGGACAAATTCATCTGCAACCGACAGTCACCGAGATGACTCCATTGACTCGATGCCGCGTCCAATCGATCAGGCG
GCAACTGCGAGCATTGTTGACTCAACGAGCTCTTTGAATGAAGCCGATAGCGAGCCACCGACGTGTACGACCAACGAAGAATCAGCCGCGCTCGACGATA
ACACAATTGAAAAACTGAGCGACCACGACCTCGAAGTACTGTCCGAGAAGCTGCTGGAGCAAGTGGTACGGCAGTTAATCGCGCTCGCTCACTCGAGCGA
CGAGCTTCTCGAGGAACTCAACTCGCTCGACGAGACCGGGCTGAGCTTGCTGCACTACGTCAGCTTCTACAACTACACGCAGCTGGTACCAGTGCTGTTA
GCGCACGGAGCGCATGTCAACCAGCAGAGCACGCAGGGACAGACTGCGCTTCATCTTGCAGCGGGCTGCGGCCACGACAACCTCGTTGCTGTGCTTCTCC
AGTCGGGTGCTGATTCGCAAGTGTTGGACTTTGACGGTCTCACCGCGGCAGATCGCGCAGAGAAGTCGGGCCATGCTGAGGTAGCGAACACTTTGCGCTG
CCACATGTCCGAAACTGGAAACACCGGGTCGGTTGGAACGGCATCTCCGGACCCGCTTTTTGAGCTGAGCGAGAGCTATTCCATGGACATTGACGACGAT
CCGACGCTGTACCAAGACTGCGGGCAGATGATCCCGATGCCCCTTGACATTCAATCGCCATGGCCGTCGTCGACCGCCAGACCGCACGCCGAGAGTGCAG
ACCACGTAACCAAGTCGACTGTTCATTGCGTAAGTTGGTTCGATTCCATTCGACATGAGACTTGAGTGCGTAATGCTCATCTCGAGGTTATTGTGTCTTG
TGCAGCAGGCCGACGAGAACCATGAGCACAACCGCAAGTTCCTGCTCGGCGCGTTCTCGACGTTGAGTCTGCACGACAAGTGTGCGCTGTCGCTCAGCAT
TTCGCGCGATGGCGGAGGCAGCTCGAGACGTCGAGGAAGCAGCGTCAGCGACGAAACGGCGTCGGTCGCGAACGGTACTGCCTCCTCGATAAACTCGTCG
CCTGCACCGAGCGCGGATCCTGGTTGCTTCTCGACTGGAGAACTGTCCGACTCGATCTATGACTCGGACGTCAAGAGCGTGATCGCCGAGGACGAGGCGA
GTCTCAACAAACTGGAGGCGGCGATTGAGCTCATGGGGCCAGAGGAGCGGCAGTCTCTCGAGGAAGAGGTGACGGTGCTCCAGCACAACATTCGCGCGTG
GCTGCTGCGCCGGAACTGCAAGAGCATGCGCGAGGCAACCAAGCGGCTGCACGAGGCGACCAAGAGCATCGAAGGTCAGCAGCTGCAGGACCACGCGGAC
TCAATCACGGCGTCAACGCCAGATAGCGAGCGTGCGTGGGACCGCGAGCGCGCTGCAGTGACGCTGCAGGCGGCGACGCGCAGCATCCTCGCGCGCAAGA
ACTTCCTGCAGACCAAGCACGTGGCCATAAAGGTGCAGGCGGCGACGCGCGGTGTGCTGTGTCGCAAGCACTTTGCGCGCATGAAGGCGCAGGCGCAGGC
GTCGCTCGTTATCCAGCGCAACGTGCGCGAGTGGTGGCACAAGCAGCCCTCGGGTGGCGGCGAGCCGTCCGAGGCGGTGCCTCCAAGCGACAAGCTCGAG
CAGAGCGACGTCGACATGACCAGTGAATTAGTGTAGCATACTCATCGAGGAAAGGACCCAGCTCCATACACCAACAGGACCAGCTGGCTTCTCGAGTCTA
TTACCGTTGCCGAGAGAGAGAGAGAGAGAGAGAGAGCTAACACCCGAGTCGGCGCTTACTCCTCGGCCTCTTCGTCCGTGTACCGCCGGAAGTTCTCGAT
CGGTGGCGTCCACGTCGCCAAGGTGCGCGCGTCTGGCACGGGCGCGTCGTCCTCCTCGAGCGCCTCCTGCTGCAGGTGCGGCGGCAGCGCGTTGATAGCG
TCCCACTTGAGGTCGATCTTGGTCTGCAGGTCGCGCATGAAGTGGTTGTGCGCGATCGTCGTCTGCACATTGTAGCGGTGACCGACCTCCTGGAAGCGCG
CCTGTTGCTCCTCCGTCCACTCCTCGCTGTGCACATCCACACACACACACACACAATGTCAGCCACTACGCCGCCTCATAGCTGCTAAGATTAAACCCAT
AGGCGAGACGCACGCGTCCGGGTACTGGCCCTTGATGGCGCGCAGCATCTGCTCAAAGTTGGCGTCCTCGCCGCCCTTCTTGCCCTTCTTCTTGGCCGCC
TTCTTGGAAGCGAACGGCCGCACGCCAGCGGCCTCGAACAGAGCCGACGCGCCGGCGCC