Description :
From Genome Similarity Track
Location :
scaffold_110:960- 3004
Transcript NameFunction/comments
g3799.t1 hypothetical protein PHYSODRAFT_556010

Sequence
2044 bases(100 bases per row)
CAAATACAGAGGCCCTCTCTATCTCCTTCACTCGTTCCCCCTGCTTCTCCCTCCCACTGGTATGCTATTGCCAAGCAGGAGATACAGGCGGAGCCCAGCA
GAGCAGCCTTGGCAACTGGAACTGAGTAGCGCCCACAAATTAGGAACTAATCTAACAGTCTAGTCTATCAAGTCGACGTACATCGGCTACCGGTAGTCGC
TCGGCCGATCGTGCAGGACGAAAGCTTCTACCAACCCCAAAAAACACGATCTGCCTGATCGTAGCGCCTAATCCGCCAGAATCGTCTTGATGCTGTCGCG
TTTCTCGTTGGGGCCGGCGTACTGCTTCCACGCTTCCTTCTGCTTGTGTGCCGTGAGGTGGTGCTCCAGAACCTGCATCATCATTTCCTTGTCGAATACC
GACGTAGGCGAGCCATACGCGGCAGCCTGGAAGGCAATTACAAGCTTGGACAGCTCACGCCCAGAAAAGCCCTCAATACGCGCAGCCAAATCCTCGAAAT
CCGAGTCCTCGATGCCCTCGACGTAAATTTTCTTCGCTCGCGAGTTCTTTGGCGCACGGATGTAGTCATCGAAGTACTGCTTCAGCATGCGCACACGCTC
ATCAAAGCCTGGAAGGCCGAACTCCACCATTTCATCGATACGATCGTTGATGGCCCAGTCAAACTGCTCCGGCTGGTTACTGGCAAACACGATCATGAAC
TTGTCGCTGGCCTCACCGGTGCGGTACAGGAAGGCATTCAGTGCATTGCGCATATCTTCGCTCATAACGCTGTTGCTACGCTTCTGCAGGAACGCATCAG
CCTCATCAACGAACAGTAGCAGACCACGACGGCTGTGAGACGCCCAGTCGAACAGCTTGTGGATCTCCGTTACACCCTCACGGCCCAGAGGTGCAACATC
ACCACCCGTAAGGATAGCGTACTCCAGACCGGAGTGACGCGCCAGAGCCTTGGCAAACAACGTCTTACCCGTACCAGGAGGGCCGTGCAGCAGCAAGTGG
CGGAACGGCGCTCGGTTCTTCTTTGTGTTGAAAGTGGACACAGCCACGCTGCGCAGACGCTCGTCCAGCTTAGGCTCCAGCACGACGCCTTCGAGCGCAT
CCGTAGCCTTCTGAAGACGAAGCGCGCGCTTGATGGACGGGATGGGGTTCGCAAGCACCTGTGTAGCCGAGCGACGCGAGGTTTCGCGAACAAGCGACGG
CTTGCCCATGCGAGCCTCGATGTACTTGCCCGCCACGTTGGTAGACACTTTAGCGGTGTAGATACCAACAGCCAGGGCCGTCAGAGAGGCCACAGTAGCC
GTGAGTTTCTCCTTGTCATCAACGAAGGTCATAATACCGGAGCCGACCGTGTTACCAGCCAACTTAATACCCTCCATGACGGTCTCGCGGTACTCCTTGG
CGCGAACACGGGCCTCCTCGAGGTGGAGATCGTGGTTAAGACGCTCCTGTTTGATACGGCCCTCGGTTTCGGCCACGACCTTGGCCAACTCAGTTTTCTG
ACGCAGCTCAGCCTCGTAGTCGAGTGTTTTGCGGCGCGAGGCCTCCTGGCGAGCGAGGATTTCCTCCTGCTTCTTGAGTTCCTGCTCCTTCATGTACTTT
TGAGCGGCCAGCTGGTCGGCATATTGCTTGCGCTTGAGCTGGTCTTGGTACTGTGCACGCTGCTGGTGCTGGCGCGTCTCTTCTTCGAGGGTCTTGCGGC
GCTCCTCTCCCTCCTTCTGCACGCGCACGATCTCGTACTGCTTGTACAGGGCCTCGTTTTCTTTCACCTTGGCCTGATTCTCCATTTGTTTGGTGCGCTC
CGTCTCCTTAGCCAAGTTAAAAGCCTCCTTGGCGTGGCGCGAGTTCTCCAGCTCGCGAGCGGCCTTGGCGGCGCGTTCTAGACCGGACGGGTCGAACGAG
TAGCCGTTGCCGGCGCCATTTCCTCCGTTGCCCTTAGGCTGCGGCAGTGTGTTCTGCGCCGAATCTGCGGCCTCGGGCGCGGGGGCACTGCGCTTAGATC
CACCACCGAATACGTTGAACATGGTGCTGGGAAGTAGGGAGTGA