Description :
From Genome Similarity Track
Location :
Scaffold_371:96- 3562
Transcript NameFunction/comments
Phyra_85917Amino Acid/Auxin Permease (AAAP) Family

Sequence
3466 bases(100 bases per row)
TATCGAGGAGCTTCAGCACTGGGTTGTCGTCGTCTCGTTCGCACATCGGTTGCCATTGATCTCCGGTGCTGCAGCTCCTTGCACTCTGTGAAGCTGTGAT
TCACCTGTGCTGCAGCTCCTTGTACTTTGTGGAGCTGTGGACCACAACTCCACAGCCTGTGGTTCACAGTGTGAAGCCTGCTGGGCTATTACATGTATAC
ACGTAGAAAAACATACGTGTTCTCTACATGCACAGGTAAATAATATAAAGTACAGTACCGGTGCCGTAGGTGCACCGCCGCTCGCCCTTTAACGATCTCG
CTACCAGTATCACGGTAATGCGTGCAGACGCTGGATGTCCGCGTGGAGCCCTGCGCGCGCTGGTGACGCGCTGCTGGTCATGGCGCGAAAGCCCATAACG
TTGTCCAGGGTCTATGGAGAAAAGAATCCTTTCCCAAGGCCGTGTGGGCGGCCAATGTGCTGAATCAGCACTGCTGCAATTTAGATACGCGCAAAACCGA
ATACGGGGATGCTCTTCTCGAGTGTAGGGCCAAGGAGGATGGGGCCGATTCCCTGCATTGCACCGGAACCCCCTTACAAATTGTAAGTACAAGTACATGT
ACAACTCGTTCGGGACGAATTGCTGCACGTAGGAGGAGGATGCGCCGGACAGCCAGCGCTCCGTCTCCGTTGACGGGTGGTGGGAGGCCCGTATCACCGC
TGCCGCGCATCCTTCAGTGATATTAGCCTGCGAGGCGGCAAGCCCATCGCCGCCGCTGCACATTGCGGACGCTGAAACCAGCACTGCTCCAGCAAACAGC
TTGAGGGTAAGGGCGTCTTCAACATGCCTCGGCGCCGTTTAGCAGCTCGCCGCTGGATTTGTCCAGCGACGATGCCGTGGTCTGTCTGCACGCAGCTCCA
TATCGGTACATGTACATGTAGTGGGCTGCCGGGCTGCACCCCAGTGAAAGCCTCGAGCGTCCCGGTGTGGGTGCCGTCCTGGAATCGTGTTGGCCGGGGA
AATCCGGAGCGCGTGCGCAGCTGCTGTCCTCGACGATCATCGACCCTTGCGCTGGGGAAAGAGAGTGGCCGCCTTGCACCGGAAAGGCTCCGCGACTGGC
GGCCAGGTCGTCCCTCGCAATACGGTCCAACGTGAGTTATCTGGAGGATGGGGCGGCAGCAGTAACGGCCGCTGCTGTTCCTCAGACTCGATTGCCGCCG
AGAAACAATTGCTGTGCTGTTGCTTTCGCTTTCAACGGGCCGGGTTGCCCGGCCCGCGACCTGCAAGAAGCTATGTATGGACAATAGGCAAGTTGCTTCG
TCCACATGTGCCGTCGCATTATTATTGTAGCACTGTGACAGTCGCTGAGATGAGATTGGCGAAAACGCATCCCGCTCAACCGTCTCATGGAGACTTAATT
GCTTGAGACGGTCGCCTCTAAACGGAGGGGCCCTGGAGCGCGCCGCCCGCGCTTTGCCTACCTGTGGTGCTCCGTATCTCGCCAGGATACAAGTCTCTGC
TGCAACGGCAACTTGTTGCAAGCAGGGACATGAGCTCTCGAACTTCGAGTCGAAGCTCTAATCCCTGGCTCTGATGCAGCCAAGTTGGCCCGACACAGGA
CGCTTGCACGGACACTTGAGCCTAGTATGGTTACCTAAAAAAGAGCGTCAAACGCATCGGCTCTGTTCGAGCGCCGTTCTCACAAGGCAAGTCTGCAGCG
GTGGACGAGTGCGAGCCGCATTAACTCGCTCACTTTGGAAATTTTCTTCTCCTAGAGAAGCCCAGTAAGCAGCGCCGTCTTCCTTCGTCTCGTTCGTTCC
ACGATGTCGGCCGCCAACGGCAAGACTGCCTTCTTCACGATGGAGGACGCCAAGGCGTCCTTCAACCTCTTCTGCTGCGTGTGCGGTATCGGTTCGCTGG
CCATGCCTTCCAACTACGCTCGCGCCGGCCCGTTGTATGCGTCTATCGCGCTGGCCTTCATGATCTTCGCCAACACGTACGCTACGCTCAAGCTGTCCAA
GGTGATGCTGGTGGCGCCGTCGTCCGTCAAGACGTACGGTGACCTGGGCGAGTGGGCCCTGGGCAAGTGGGGCCGCTTCTTCACGGTCGTCTCTCAGATG
GGCGTCTGTCTGCTGGTGCCGATCGCCTTCCTGGTGCTGGGCAGCACTCTGCTGGACGTGCTGTTCCCGGATTCGTTCAGCCAGATCTTCTGGATCATCT
TCATGGCGCTCATGGTCATCCCAGTTTGTCTAATCCCGACGCTGAAGGAGAGCGCAGGCATGGCGTTCGCCGGTTGCATGGGCACGGTCATCGCCGACAT
CATCGCCGTGTCGGTGTTGCAGTGGAACATGCGCGGCCACGGTTCGATCCCGTCGCCAGACGTGACGCTGCACCAAGTGCTGACGTGCTTCGGTAACCTT
GCTTTGGCGTACGGTGCTGCCATTGTCGTGCCCGATCTGCAGCGTGAGCACTCGCAGCCGCAGCGCATGCCGCGTGTGGTGGTGATCACCATTCTGTTCA
TCTCGGCCTTCTTCATCGCTGTTGCTCTGGCTGGTTACACGGCCGGTGGCTGCCAGCTTTCGGGCAACATCCTGTACTCGATCGTGAGCACGTCAGACCC
GCTTGGCCTGGCGCCTTTGGGCTTCAGTGCCGACCGCGGTGCTGTGGTGATGTCGTACCTGTTCATGCAGGTGCACATCTCGATCGCTTTCTCGACGCTC
ATGATGCCGCCGTTCTACATGGCGGAGCGCCTCATTCTGGGTATGCACAAGGGCCCCGAGATCGTGCGCTTCAACGGTGAGGCGGACCAGGCGAACGTGG
ACCTTGACCTGGAGATCCAGGAGAAGCGCTCGTACATCCAGAGCTCGACGCCCATGGACACGGCCAACCGCCAGGTGTCTGCTTCGAGCTTGGTCGAGAA
GTCGGAGGGCCGTATGTCGCACCTGCGCGTGGCGCTCGAGTTCGGTGAGGAGATCACGGCGGAGCAGCTGCACGAGCCGTACCGCAACAACCCGCTGCGC
TACATCGCTCTGCGCATTTGCATCATTGTGATTCTGGTGATCATCGCCGTGCTGGCGCGCAAGCGTTTCCTGGACCTGGAGGACTTCACGGGCGCCACTG
CCCACACAACGAGCTGCCTGCTCATGCCGCTGATCATTTACCTGCGCGTGTTCTGGAAGAGCATGTCAATCCTGGACAAGGGTGCATCGATGCTGGTGAT
CCTAGTATGCGCGGTCACTGGTTGCTACGTGATGATCCACGCCGGTAAGCAGCTCTTCACGCCATCGGACGACGATACACTGTTTTCGTACTGCGAGGCG
GAGTTCCAGGACCAGCCATACTACATCCGCAACAACAGCACTAACTAAGCCGAGCCGCCGCAGCACAGCTTGGTAGCGGTGATATATCATAGTTTTGAGG
TTGGGATAGAGGTTGTGTATCCGTGCCCAGCAAAGAGCAACAATAAATACAGTGTCTCGTGTTGTA