Description :
From Genome Similarity Track
Location :
Scaffold_2451:96- 2966
Sequence
2870 bases(100 bases per row)
GGCTTTGGGAGCCAGCAATATCTACGTGGGATCTTGTGATGTCCTTTCGCGACGTCAGAGATCAAAGTTCTCGATTGCTTCGTAAGCAGCGGGCGCTTTC
GAGATGATCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAG
TACAGCGCTGGGTACGCGGGCTTCGCTAAGCCTTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACA
GCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCGGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTG
TGCATTGCTGCAGGACGACACGGCTGGGACAGGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACA
AGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGAC
GGCGACTAACTCGCTTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAAC
GTGCTTGCGGACGCCCTCTCTACGCGTCCGACTATGAGTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGAC
GATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTTAGGCCGGAGCGAGCGCAAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATG
AGTTGAAGGAGGGCCGCCTCTATTATCGGGTGGATCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATATGAAGTTCGACATCCTCGCGGA
GGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCC
CGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAGCCTGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGT
CGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGC
TCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCTGAGACGATTGTCTCGGACCGA
GACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATTCGCAGACAGACGGCCAAA
CAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGCCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCT
CAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACAGCGTTCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCC
TCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATA
CCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTGT
ATTTAAAGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGA
CCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGT
ACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGC
ACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGT
ACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGGACGTGGCAACAAAGCCTGATTGCGTTCGAATCATGCGAAAGGCC
TCCTTCCCAGATTCGGAAGCGAGAGAGGCCGCGGCGGTTCCCACCCGGCAGGTGGCAGTCTTCGCGACCTCTCGTTTCCCAACGAGTTCCCAGGCGACCG
GCCAGGACGAGCGAAGCTCGCCCTGATTCCGGGGCTGGGGCGGCCACACTTACCCCCAATTCCCCAGAGGCACAAGGGACATTTCCAAGCACGAGGAGAC
GTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTA
CGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCT
CGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGC