Description :
From Genome Similarity Track
Location :
scaffold_333:96- 1491
Sequence
1395 bases(100 bases per row)
GGTTTTCTGCCTACAAAAATATGGCggtatttgccgaagtgaagaagagttGGAGAAAACCTCCTCTTCTTGCGACTGCAAACCACGATAATACTTTTCT
TGTGGTCTGCGATGCAAGTGATTATGCCATCGGCTATGCGTTGATGCAAAACGATGATGAGGGCCAAAAGCGAGCTGTTTCgtatcagtcgcgacgaTAC
CGGCCTGCGGAACGGACCTATCCAGTttatgacaaagagcttctaGCAATGAGGTATGCTTATCTTACGTTTCGTGTCTACTTGCTTGGAGAGGAGCGCT
TTGCTATCTACCCAGATAATGCCTCACTGCGTACGGCAGTCACGACTCCTCATTTATCGCAAAGAATGCTTTGATGATTTTCcattccttctttgcggtg
tATAACTTTGTTGTACACTACAAGCCAGGCATGACGAACATCTTTGTTAAGACGTCCGTACTATGACCCAAAGTCCAGGAGCGAAAACATACacgagtca
tgtcgacaatgcgaaGATGTTCGGACGATCAGAGTACAAGTAACGACTACAGTGcgcgaagaaattgtcgaaggGTACAAGTATGATGAGACATGTCACG
ACTTGTTGAAGTATTTCAATTAACCTTCCGACAAAGCTCTGCAAGGTTTTCTTCTCGCACGAGATCGCGTGCTCACCGTGTTGGAGTACACAAAAAGATT
GTTGCACTATTCGGCATGAGTTGTTGTTCCAAATGACGAAAAGGTTTGCGTCATCGTATTTTATATGAGTACCATGACAGCCCTTCGGGTGGCCATCTCA
GACGTGATAAAACGTTTCTCAGTCTATCCAGGGATTATTATCGGCCACATGTATAATTGGGTGCGCAAGAACTGGTGAGATCTGCGAGAGAGGGAAACCA
TCGGGTTCCACTCAGACCCCACTTCGGTCCCTGGAAGTATCAACTGACAGCTGTAAGTCCGTGAGTATAGACTTCATCTTCGGAATCCCGCGTGACTCAC
ACGTACACAGTGGCATCCTTATGTTTGTGGACCGATTCAGCAAGATCGTTCATCTTGCGCCTGTTTCTGACAAGAACTCTACCGAGAAGACAGCTAAGGT
CATTGTTGACGTTATTTCCGTCTTCATGGCTTTCCTGTTGAGATCGTGTCTGACCGTGACATCGTTTTACGTCGTAATTTTGGCGTGCACTGATTGGACT
ATTGAGCACCAAATTGTCCATGTCAAACAGCGGCACACCCTTAAACGAACGGCCAAACAGAGCCTGTGAATCGAGTCCTGGAAGACGTACTGCATAGTTA
CGCTACGTCGCTTAAGAGTGGTGTCGATTTCTTCCTCTTGTTGAACAACTTCACGCATGTCTCGACAGGACATTTGCCATGCTATGTGAACTATG