Description :
From Genome Similarity Track
Location :
Scaffold_1011:96- 1322
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1011-fgenesh-gene-0.0Multiple inositol polyphosphate phosphatase

Sequence
1226 bases(100 bases per row)
AGCTTGATCCTGGGACTTCTCTTCCATGACGCTTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTTGGAAACTAAACATGTAACTCACACAGGCTCGCACTCCTCCGCTGCGC
CAAGCGCTCTCCACTACTCAACCGCTGGCGCCGGATCGCGCCATCCGGGGGCTGTGCGTCATGCGGCGGACAATGAGAGCTTCCCGTTACAGTTGCGTCC
CAGACTGGTACGTAGCAAGAGGCGGCTTGAAAGTGGGAGCTGTAATACTATGTGCTGCTTCTGCCAACCGCGGTCGTCTGCAGGATCGCGCTCGTCGTCT
TCTCTCGCGTCGCCACCCTTGATGCCAATTTCACCTCCTGGTGGGAGTGTGCGGGAGACTCCCATTGAGTACTCTGGATATCAAACCACCTCCAGAATCC
CCTTTCAGATCCGGTTATCATCTTAGATACCAATGTCAAAAATGTCGAAAATAGAATCTTGAAAGATTCCAGTTTTGGCCAATGAGAAGCACTCGAAAGG
ATCACCTGCACTTTTTATGCAGTGACAACCAGACGACCTTGATTGATCTGTCAAGAGATTCAGAGTTCAAATTGATAGTGTATATTTTCATATTTATTTG
TATAAAAGATAGAATTCTAGGAACCTATGTATCTTTTATACTGATCTAGACACTATGATCAAGTCACAGCACATGTTTTCAAATGAAATGCTTGCATTCC
TGAACTCACTCTTCAATCTGCGGCATGCTTGTCAAATTCCTGGCCGCCGCGGCGCTCCTCGCGTCCGTGCTCACGGGCGTCGACGCCCAGCAGCAGCAGC
AGCAGTCGGGCCGCCCAGTGAACCCGCACTCGTTCGCGACCAAGACGGCGTACTGGGACCAGCGCAGCGTGGACGACTACGACCCGCAGGTGGCACTCGT
CAAGCTCCTCGCGCGCGAAGAGCTCA