Description :
From Genome Similarity Track
Location :
Scaffold_1378:96- 1171
Sequence
1075 bases(100 bases per row)
cgaaagttccaagcgctacgtcacaCAAACGTCCACCCTCCATAGTGAAGCTTGTACGCGCCGTCAGTCACCCCAAGTACGTGTCGGACATCTGTAGACC
GCTGGCCAAGAATTTCACGTGGTATTGTCTGAAGCAGTCGGCTCGATGTGAAGGTGATACCAATCGACTGCTCTTCATTGTCCAGCGTATCGGTAAAGCA
ATCCAGAACAGTAGCTCGTGCTGATACGCGTGCGGCTGCTCTCAAATACGCGAGCCATCATGCTCCACGATGTACCGCATATGCTGAAAAAGCTGCCCTT
TGGTTGTGCACATATGAGACGCGGCCCACTCCATCACATGGCAACAGTAGCAATTTTGAAGTCGCCACGCTTCCGCAGTTTATGTGCCCTGTTTTCGAGC
TGTGTCACAGATGAACGAAGCGCGAGTCTATCGTCTGAGTTCTGGTATCTTGTCCGCAAAGTCGCCAAAACGATGTTAGGGCCTTGTCCACACAGCAGTT
GATTGTCAATCTATTGACCAGAAAGGCCTGTGGATGCCGATCCTTTGCGACTCCCTCGGTATATGAACTACCTACCGCCTGTTCGTGTGGTTCCGGTTTC
CCGTCTCTGCAGTATAATCAACGTGCGAGGTGCACTCTAGCAGCGTCGCCATTCTTTCGTTGTTTTAAACGGAAAAGCGCGCGTTTTCAAGGCCTCCGAG
AACCACCGTCGCCCCAATCATCGTGTCGATCCGCACAAGATGCTTTATGATGGTCATGTCCCTTTCGTTCTGCTGTGGCCGGGTCGATTCCGTATCAAGT
TGGTCAGTTGACGAAGCGAGGCTGCAGCCATCACTGTCGCTATCGAACTCTTAagtgtcgtcgtcgccgtttCTGCTACGCCGTGATTCATCCGCCTCCA
ACCTAGCATCGGCCGCTTTCTCCTCACTATCGCCACTGCGCTGACGGCGACGTGATGATGCACCAGAGCGAAGGCGGGATATGGTCCCGGTGAAATCCGC
ACTATTGCTCGAGTATGGAGGGATGGAGAAAGAAGATGGAGGCCAGGTGTAGCGTCTGCTTGCATCCGTCGTCAT