Description :
From Genome Similarity Track
Location :
Scaffold_40:9596- 11658
Transcript NameFunction/comments
Phyke_g5585hypothetical protein

Sequence
2062 bases(100 bases per row)
TCGAGTGCTATCTGGACGCCCACGGTTACGTCAAGACACGGTCGTACCTCAAGGGTAAATTCCTGGGCAAGGTAATCTGTCGGCTTGGTGTTGCAATACT
CTGTTGgttggttgttgttgacGCTGGAGTTGGTTGTTTGCAGGGAGGATTCGCACGTTGCTACGAACTCAAGTGCGAACAGACTGGGACGGTGTACGCC
GGCAAAGTAGTGGCCAAAGCGTCGTTAGTGAAACCCAAGGCTAAGCAGAAAGTGAGAGCTGGGTCGTCTTTTGCAGAGGCTTGGGCTTGGGGATTTGACA
CGctttgtttttgttttggcTTTTTTGTTATTGCTTGTGGTGTAGTTTACGTCGGAGATCAAGATCCACAAGTCGCTGAATCATTCGCAGATTGTCCAGT
TTGAGCACTTCTTTGAGGATTCAGAGAATGCGTACATCTTGCTAGAGCTGTGCCGCAACCAGTCGATGTCGGATCTGATGCGCCGACGGAAGCGGCTTTC
GGAGAGCGAAGTGCGATTTTACATGCGGCAACTTGTGGAGGGGTTGGCATATTTGCACGAGCATTTGGTCATTCATCGTGACCTGAAGCTCGGTAATTTA
TTCCTCACGTCGGATATGCGGCTCAAGATTGGTGACTTTGGTCTGGCCACTCGACTTGATAACCCTGAAGATCGCAAGCGCACCATGTGTGGCACACCAA
ACTATATCGCTCCAGAGATCCTCAGCGGTCAACGCGGTGACGGACACAGCTTCGAGGTGGACATTTGGTCTACAGGTGTAGTCATGTACACATTGCTCGT
AGGTCGACCACCTTTTGAAACCGATGATGTGAAGGCCACCTACAAGCGCATCCGAGCCAACCAGTACGACTTCCCAGAAACTGCACACGTGTCACGTTCA
GCGCAGTCTCTCGTTCGTGGGATTCTGCGTAGCGACCCGGGTGCCCGGCCCTCTCTCGAGCAAATTTTAAAGCACCCGTTCTTGGCTAATGAATTTATCC
CGACTGCACTGCCCAGAACAGCGTTGCTTGTAACACCTCCGTCGTGCAAGAGCCAAACTTTCGCTAATCGACACAGCGATAGCGAACGCTTTTCAAGTTC
TGCCAGTGTATTGAGAGTTCCACCCCCGCCGGCAGCATCAAAGAGGTATCCTCTCCAGAGTCGAGGCGTCAATACAGAGCGGGCGTCTGATCCAGGGGCT
TCACCTTCGATGGCTCATTCATTACCTCCCGCTCATAAGCACGACGGTGCCGGAAGATCGTCGGTGCACTCAAATTCCAGTCGAAGACACTTAGCTTCGA
GTAGCGGCTCTGCAACAGTAAGATCGTCAACTTCAGGAACAAAAGAAGCCGCTGCACCGGTATCGTCACAAAACGTGTTGGAAGCGGCTTACAAGACCTT
GTCAcgattcttcttcttgcaaGAGCACGGGCatggaggcgatggcgagcACAAATTGTCTGAATCATCTTCGGCTTCCACcatcgttgcagcagcacag
agaTTGAAGGAGATCCGCGCTGAGGCTGACGAGACGAGGCCACTCAACCCAACCAGTCTGTGGGTCTCGCAGTGGGTAGACTACACGTCCAAGTACGGCA
TCGGCTATATGCTATCAAATGGCGCATCAGGTGTGTACTACAACGACTCCACCAAGATGATTTCATCAGCAGACGGCCGCGTATTCGAGTACATTGGGCG
TCAGAGCAGCGAGCACGCAGGGGTGCCAGAGTCGCGCGCCCGCTTTTCTATGGATAGCTACGATCCGGCGCTAAGCAAAAAGGTAACGCTACTGGGCCAC
TTCAAAGGCTACTTAGTAGACGCCCGCGCTGAAAACAACGAAGTCGACACCCTTGAAAACCAGCTTGCGCGGTCTTTTGTTCTCTCGTCTCGTGAGGTGG
GGGCAGATGACAGCGGTAttgtcgacgaagcagaGCCATCTATGGTGTTTGTGAAGAAATGGGTCAAGACTCGGCACGCGGTGCTCTTCCAGTTATCCAA
CGGCACGGTTCAATTTAACTTCTTCGATAAGTCAAAACTGATGTTGTCGTCGGACGGGCGCG