Description :
From Genome Similarity Track
Location :
Scaffold_322:9596- 11353
Transcript NameFunction/comments
g10061.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae
g10062.t1hypothetical protein

Sequence
1757 bases(100 bases per row)
GTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCA
GGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGTTCGGTGATGCGTACTGCTCCAGGGTAGCAGTACTCACAAGCAGTGTC
ATAAGGCACTGCGCAAGGAAGTCCGATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGG
CTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGC
GAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGC
GACGTCATCGTCAACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATC
CACGGCTCGCGCACTGGCTCAGTGCGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGA
GCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGG
AGACAAGGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCACTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATACCCACTCCG
GTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCG
CGCTTGTCGGCATCGCCGTCGAGGCGATGTCAGTAGCGGTCGTGGCTGAGGCAGCGGCTGTCGTCGCCTCCAAGGCAACGACAGCACTTGTTGTTGCCGA
AGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCAC
GTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCA
CAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCAT
CCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTCTCGTTTGGTTCA
TTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAG
TAGTGGGTCTAAGCAGACCCATTACAGAGATCAAAATCTTGGACGGAGTACCCACTGACACTGAGTAAGTCTTGGATACTCTTCAGAGTGTCGAACGTCA
CAACAGACGTTTTAAAAGGGTCCAACAGCTTTCGGTTCCTGTACGCATAGTCAAGCG