Description :
From Genome Similarity Track
Location :
Scaffold_448:95953- 97752
Transcript NameFunction/comments
Aphin_H310_10028Hypothetical protein

Sequence
1799 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCATTTTGAATACTGTGCCATGTGATATGGCTTCGCAACTGACATGTCAACTAAAGTATTTCCATTGCAATAAACACAAAAATACATATATA
TCGTGATATACCATCAAGAGTTTTACTGTGCGCGACCAATGCTTCGTCCGTTGACATCAATGACTCTCGGTGGAAGCCTTTTTTGTCGCTCCAAAATTCC
ATCATAATGTCGTACTGCAGTGGCAATGCACTAGCTGGACCATTGCCAGTCTTGCTGGGACTCCAAGGTTTCGTCAATGCCCAAGCGGCCTTCACTTTCA
AGAACTATAGAGCGAAAAAAAATGGGAGTTTATACAGATACAACAACTTACCTTGTCTTGTACTTGAGCAACGGAAAACTCTTTCTCCGTCGACATGCTC
AACTCCACCGCCAGCATAACATACGCCGCCTTCTTCTCGGCGTTGTTTTTCGAGTCGAAACGCTTGGCCAACTGCGACTTGCACCGAAGTCGGAACAATT
CATGGACACTCTCGTCATCCCAAAGGGAGCCTCGCTTTGGGGTGTCGACCGACGTGCGCTTTGCGCGTCTGGCCTTCTTGGCCTTTGGCGTTAGTTGCGC
TATGTACTGAGTGTCAGCATACGTTGAACGTAGACATTGTAGTGAATACCATGGGTTTCTACATCATGCGTGTGAGTGTCGTCGTCATCACTCATGGGTC
AGTCTGCAAATTGACTGTAAACGAGGAATGGCTGGTACAGGGCAGGAACGCCACATCCCTGCCTCAACCCAAATTGTCAAGCAGGAACATTATGCGGATT
TCGGATATATTGACCAATCAAATTGATTTTGTCCCAGCCTGAATATCAAAAAGCTGGAATGTATTCAGCGACCAGGCTCTTAGTTGGTGTCGCAAGGAGT
CAACCAAGAACAATTCTATCGCACGCTACAGCGTTCTGCGTTGTGCGTGGCTGCAATGGATGTGTGCTCCCACCAAATTTTTCGTAACTTAGGTCCTTTT
CCGGTAGCCCAAACCACGTCAGATGCCATTGCAGCGTTCTCAGACCGCGCGCTTTGCCTTGATATCCGAGCTGTCATTTGATTTGACCATGAAGTCCAAC
ACAAACTCGCGCATGATACACGCCGAGGCTGTTCATGGTCAAGTTGTGCCTAAACCTGAACAGGACGGCGTAGTCCATCACGAGCACACCCACGACATTC
GCGACGAGGTCAAGCATGATGGCGAAGGCCCCGCGGACGTAGAACGGCCCCGATCGAGCAGTACAGGTTGCAATGGCGGATCTGGCCCAGATTATGCATC
GACGTCACTTGCCCAGCGAGGAGCACCCCGTGCAGTAGCTCTTGTTGAACCCGCGATACCGAGGAATGACTCAGGTTGCTTTGTGGTCGTGGTGCGAATT
TGCAACCGTTGCCAAACTGTATATCCCCTTGCTAGCGTGCGGGTTCATATGTCGTGGCTTTCAAATCGAACTTGTACCATCGCGCTGTGGGTACGTTGT