Description :
From Genome Similarity Track
Location :
Scaffold_624:9594- 11466
Transcript NameFunction/comments
g15688.t1hypothetical protein
g15689.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
TCTTCGTACTCTAGTGGACTGTAGTGTGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTA
TTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTA
TCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGGTCGACTGGATGAAGCGCACGATCGTGCG
CTTTGGGAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTTGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCG
GCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTAAACCGAATCAGCAGGACGTGGTTCAATCCGATTCGAGAG
GGTCTCGAAGCGTCCGGAGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGACGTCGAGGTAAAGAAGA
CGCGGCTCTGGGAGCCGACGCTGTAAGCAGTGCGGGCGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCTGGCTGCACGACGAAG
CGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAATGAACAACTGTCCACGGCCTGGCCTGGACAAGAAGA
AACTCGCGGAGCCGGGCTCTGCACAAGAAGTGAACGGCGCAAGTAAACCAAGCTGCGCAAGTCTCGGTCAGGGACCGAGATGCTACCAGCAGTGTCTGCC
GGGCAGACACAGGAGTTGGTGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTC
CGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTC
GGACGTCGAGAGGGTGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGACGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGAC
GAACAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGG
ATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGA
CTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCACACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGC
ATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTA
TCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTG
GGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGT
TATTTCGATGATGTGTTCATTCACAGCCGGGCTGTGAACGGGAAATCGGATGTGGAGATGCATACAGAACAT