Description :
From Genome Similarity Track
Location :
Scaffold_380:9591- 12153
Transcript NameFunction/comments
Phyag_g5215hypothetical protein PHYSODRAFT_500307

Sequence
2562 bases(100 bases per row)
ctggttTTGCGCACCTCCGCATGGTATAACGTCGGGAACTCCAGGACAGTCTTCTTCGGAAGATCTTTGTCGTACGCAGAGAACACGACAATCGGGAGCG
CCGTGAAGAACAGGTTGTAGCCCTGTTGGATCAGCGCCGAGTATATCATCGTGCCCGAGAATGCAGTTGGCCACAGCGTGTACCAAAACATGGACACGTT
GTACGCGATATTCTTGTAGAATGTGTAGACGACGAGCGCCGCAACGCGATTGTAGTTCCAGCGGCCATGAACCAAAATCAAGTTGCTCAAGAATCGGAAT
TGACCCAGGGCGTAGTCCGAACTGTTCACAGCTTGCAagccttcttgtccactGATACCCACACCAATGTGAGCACTTTGAATCATGGGGACATCGTTAG
CGCCATCACCAATTGAGAGCGTGTGCGACTCGGGGACATTCAACTTCACTAGCTCGACCAGCTGCGCCTTCTGTTGCGGCGACACACGACAAGCGACCAC
AACCTTGCACAGCAGGGACACACGCAGAAGATGCAAATTGTGCAGTGGGTCTTCCAGTATCTTGCTCAGCGACGCGCCGTCGATAACAAGCGCGTGCTCT
ACTTGGCCCGATGGTGGCGATAACACTGAGTGAGCTGCAACTGTTGAAGTGGGTGAACCATcatcggcagcgtcgtggaTGGAGTGGAAAATCTTGTCAA
GTTTGCGTAGGATCGACCCCTTCGTTCGGTATTTGGCCGCATTAATCACGTGTCGCTCCATGTCATTGTTGAGCAAGCGACAAGCGTAACCAATGTTGAT
GGCCGTCTCCTCCATGTCTCCCGTCAGCACCCAAATGCAAATTCCGGCCTTGGCAAGAGCCTCCATTGTTTCAGGTACACCATCCTGCAGACGATCTTCA
ATAGCTGTGGCACCGAGAAGCTCCAGGTTCGACTCCAGCTGGTCCTGAAGATTGTCGATAGCGTTGGGCTCACCCTTCGATTTCGCCTCAACTTCGCTCA
GATCAGCAGACGCATGACGATACTGGGCGTTGAACTGCTCCCAAACTTGAGGCTTGATCTTCCTCGCACAGACAACAAGCGTTCGGAGTCCATCCTGGGC
GAAAGATTCCAAATGCTTTTCGGTCGATTCACGAATACGATCGTTGTTCTCGGACATCGGAGCCAGACGAGGGAACAACATGCTATCTGCTCCCTTAGTA
AGAAGCAGGACATCATCCTCTTCGCTTTCCGACATTAGGCGGAGCTCATCGTCACGTTTCCGGCGTTGCACAATAACCGACATACGCTTTCGGTTGGAGT
CGAATTCAAAAACTTCCAAGATATCATACTGGTCCACAACACCATCCGGTTTTTTGATTGAGACACTGCCAGGTTCACGATCGATAAATTCGTAGCCAAA
GAACTTGGCACCACAAACGAGGGCGAGCTCGTCCGGCGAGGAAGCTGAGTAGTGAATGGGAGGACTGGCATCATTTTCTGACGGGTCAAGGCGTTCGATC
AGGACACCATGGCACAACGCTAGCAGCGTCATGAATTCTTCGATTTTTTCGCTTTGCGGGTCATTTTTGTTCTGCATGTCCCACCACATGGCCTTGTCCT
TAAAGTTCACATTGGGAGCTGGGGCTTCCATGCGTGCATCCAGAACCGGGATATCGTTCTCGTCTGCGGATTCTTCGTCCACAGTTCGGTCGCCCTTAAA
ATCGTGACGCATGCGGGCTGCAAGGCCAATAGCTGTCGTACCCTTGCCGTAGCTCCGTCCACCGATGCTACATTTACGGAACTCCATCTTGTTACACGTA
AGGGTGCCCGTCTTGTCCGAGAAAATGTGCGAGATCTGTCCCAACTGCTCGTTCAGTTGCATGTTGCGCACCTTCACCGGATTGCCGCTCTCTTCATCGT
ACATATCAAGATCTCGCTCCATAAAATAGCCTTGCAAGGCCTTCACAAGGGTGATCGACACGTACAGCGTGATAGGCACCATTGAGGCGAGcgtcgtgaa
gaagtacacAAACATCTCAATAAAGGTGTCATCCCAGCCATCCAGGTGCAAATACGTCGGCACGACAAATTCGTTCATCCGAATTCGATCTCCAATGGCA
CCGATAAGCGACATAAGCACCAGGATGATGACTACAACGATCACTTGCCTGTTGGTCATCTCGTCTATAGATGAAACTTTGACAGGGAATTCATCACCAG
AGCTCATCATAATCTTGCTGTCAACACCAGTGTTCACAACCAAGCCGTACACATAACTGGTGTTGCGTAGCTTGCTACCGCGAAGCAGCATGTTCTTTAA
CGAGAGAGGAAGTCCTTCCTCATTGGCTCCGTTCGGGTTTTCCTCCAGGTATAGCGTTCCAGAGTACGTGTTGATATCACCGTTCGGCAGCTCGCTCTCG
ACGTATCCTTGAATGATGTACCCGGCATCTTCCTCGTTCATGAACATATTCCGGGTCGGCTGGGGCGCTTCTCGCAGTTTAAGATTTGTTTCACCATCAA
GGTTCTTCGTTTCGACGTAGCAGAGTCCCATATTTCCACCGGATcgtgctccttcagcagga