Description :
From Genome Similarity Track
Location :
Scaffold_1529:959- 3643
Transcript NameFunction/comments
Physo_126765hypothetical protein

Sequence
2684 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGTTCCGGT
CGAGGGCGGAGTTTCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGAT
CGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGCGAGTACTCGAGTACTCTCGAAGATGCA
ATCACTCTTGCAATGCAGGAGGAGTTTAGCCAGCGGCAGGCTAAGCTGCATGCACATGCGCCGAGGCCACAGCCTCGCCCGATAGTGAGGACGGGAGGCC
CAGAACCCATGGACGGCTCGAGCGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGTGGTAGAGTCGGTCACTTTGC
TCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCTCGG
GGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACGGCAGCCCCCAGTGAGGTTCACCCTCACTGCAAGAACCAAGA
TGACAAGCCTGACCTTGTCATCCTGAATGTGAACACGATGAGAGCAAGCGGCTCTCTCCGTACTTTGGTAGATTCTGGCGTGTCGAAGAACTTTGTTCGA
CTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCCACGGGTGCCGTCGTGAAGACCGAGAAGC
GCATGGTACGCGTGCGCTTCACGTATAAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATGTGGACGATAAGTTTGACATTGTATTGGGCATGCC
GTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTAC
GCACGCACCGACAGGTGCGCGCGACTCCCCACTCGATACAGCGCCTAATCCCGCTGTCCCGGAGCCCCCTGGGCGCGCGCGAGC