Description :
From Genome Similarity Track
Location :
Scaffold_2302:959- 2905
Sequence
1946 bases(100 bases per row)
CACTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAA
AGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACGAGGATCGCTCCTAAGAAAGAGCCCAAA
CGCCGGATCCAGATCCCGATCCCGACGGTACGAGTGGATGAGGATCTGTACGTCCTGCGTTTCGATGGATCCGCTCGTGTACGGCGCGGAGGCGGGGCAT
ACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACT
CCTTCTGGGTTTGGATTTGCTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAAATTGAC
TGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATG
CCAGTGCCGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTAGACCGACT
AGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAG
AAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGTAGTATCTGATGGGGGATGTAC
GAGACCTGGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGGTCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGA
GTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCTGGACACCTTACAACAGGATGTCCTGCACCACTATCACGCTAGCTTGGAAGGCGGACATC
AGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGGTGTCTTCCAAAGGTCGCTGAGTATTCCGCGAAC
TCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGAC
ATAGGGCCGTATCCGATATTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCCGACCGAGGGTTCGTCGC
TTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCACTACACCACACGATTACAAGATGGTGAATGCCATC
ACCGCAATCATGGAGTATGCAATGCCGCTAGTCGACGATCTGTTGACCGATCTCGAGTCTTACCTATGGTTCTGCTCGCTGGATGCTGCAAGCGGCTTCT
GGGCGGTCATGATGACCTTGCGAGCACGTAAAATGTCGGCGTTTGTCTGCGCACTCGGACATTTCGAGTGGTTACGCAAGCCCTTCGGGTTATAGAACGC
ACCGATGATCTACCAACGTATGATTGACAAAGCACTCTGGGGGTTCGTTCAGCCTAAAGGAAGTTGGTTTGAATACTCGGAGAAGATGTGTTTAGCTGAA
AAACAGACCAAGAAACGTCGTGGGCAAAGCACCGAGGGCTCGATTCAAACGAAGTTCGCGGCAGACTGCGAAGCACCGGTGGAGGCCGACCCTGTACTAC
AACTCGTCAAAAGCCCCGTCGCTGACATGTTTACGAACGGGGAACC