Description :
From Genome Similarity Track
Location :
Scaffold_2503:959- 2691
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2503-snap-gene-0.0Gene of unknown function

Sequence
1732 bases(100 bases per row)
AGTATGTCTCGGGTATGGCAGGGAGCAAGGTCGCTGACTTTCCCTGCAGACAGCAGTCTCTTGTGCCTCGCGATGACCACGTTCAGTGCTCCGTCGCGGT
GGAGAACGCGCAGCTTCTTTAGTACCGATGCCGCACCGCGCGACGCAATTCCATGGTCCTTAAGAAACGAGATAGCCTTTTCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTCGTTCAGTGAGAACCCCTCCTCGAGAAAAGCTTCAAGAAAGCAACAAGCATCTTTCCGTCGGACTTTCGCTGCTTCTCGCCGGCG
ATGGTCTACAGACGCGGTTCTTCAGCGTGCCACTCACACCAAGCGGCTCGCAGGTGAGTGGTAGATGCGCGCTCCTGGTGTTTGTTGTTGGCTCCGTCTC
TTGCTATCTTGGTCTCACCGTCATTCGCCATACGCTTGTTCTGCCTCGCAGGTTGAGCAGCTNNNNNNNNNNTCGCTTGTCTCGAGCGCGTCTAAGCGCT
GATCTTGCCGCTTCGCGAGGCCGATTAAATAGTCTATGACAGCAGCTTGATGCCGAATGGTCTGCTACTCCTCTGTCTTTGCGTTTGGTGTTGCGGCTTC
TTTTGTGTCTTTGTCTGTTGTACAGGCGCCATGAGCAGTAACAAGATGCGACGACCATGCGGGCAAGTCTGCGAGAGAGCGTTGACTGTCGAGCGCGCTC
GTCTGTATCCGCAGTACAGCGGGGCTGTTCGGGTTCACCTGCTTCAACAGCGAGTAGTGCGTCAGCAGGATGGCGGTGAGGACGTCGAGTACCCGCCGAC
TCACGTTGTACTGTGAACGCCCGAGACCACGCAACGGCGCGAAGAGTCGCTCCTGGACGGCTGTAATCTGCTCTTGCGTCTGCGTATCGAACGGCGCCAA
GTCGGCGAGTGTGACGCGCTTCGGCATGTTCCACCCGCTGAGGACTTTGGCGACCTTGTGGCCCTCGGCACACGTGTTGAACACGTAGTTGAAGGCTTTG
TTCGTGGCGCTCGCGTTCTAAGCACCACGGCCAAATATCCAGCTGTCGATCAGCTCCGCTGAACTATTCGTGTGCTGTGCGCCACCTCGTCGAAACGAGT
GAGAGGTAAGTTGCTGCTCAACGCCTGAACGCTCGGCGACGCAGTTGAGCAGATGATTGGTATGGCTGTGTATTGTGAGCGCAGAAGAGCGGTGGCGCTG
GAGAGCAGGAGATCGGGTGCGGAGTCGGGGTTGTCGAGAAGCTCGAGTAGTGGCGTCTCGGAGCCGAGCACGCCGGCGACAGGCTGAGCTTGTACAGGGA
GGTTGCTGAGGAGGTCAGCGCGCGGTGCCGTCTGCGTTGCAAGAGCCAGCGCGATTGCGAGAAGCGGACACACGGCAAAGTCGACATCGGCGAAGAGCGA
GAGACCTTGCTCCTTGCTCGTCTTCGCCCGTATGAAGCGGACGAAGAAGACGTCACCAGCGCTGACCGAGACATTTTGCTTGCGAACGTGCGTCAAGTGT
GACGCACGCCCAAACATATACCAGAGCAGACTTAGCAACGCAGCATCCTGATAGTCACTTGATGTAAATGTATTTAAATACAGGTAGCGCGTCATTCGTC
TCAACTTTGCCTTTGTACATGCAACAGCTTTCTTCACAAACCCACCGCCTTCTCTCTCTAAGCAAAAACTCTTTAGGGTTTGACCCATTTTGAGTAGCTT
AGACTCGAGAACCAGACGATGCTGTGGGAATT