Description :
From Genome Similarity Track
Location :
scaffold_615:9588- 10678
Transcript NameFunction/comments
Pl_103430hypothetical protein PHYSODRAFT_522180
Pl_103431beta-catenin-like protein

Sequence
1090 bases(100 bases per row)
TCTGCTCTTCCTCATCAACTTCATCCTCTTTCTCCTTTTCCGCGTTCAGTTGTTCCTCTCGTCTCAGCAACAACCGTTGTCTCTGTTGTTGACAGATTGT
CGTATCATGACTCCTCGCCACAAAAAAGTAGTGTTGCAGCATGGGATTATGTGCCAACGCTTGCAACACCGAGCTCATAAAGCACGTATTGCCCATATTC
ACCAGTCCTCGTCGTAGTAATCTATGAGGCGTCATCACTCCCCGAAGCTGGCGCTTACGTCTTCTAGTACCGCCACCCACTGCAGTATCAGGGTAGATAA
AGTCCCTACAGCTCGCACAATAGAGTTGTCTCTTCCTCTCCATCATAGCTTCAACAACAGCAAAATAAATAACGCTTCCCCTTATACCATCAAAATACTC
TATCCACTCACCGATAGTGTGGTTATACAGTATAGCGTGTACCATAAAGCTGCCGTCATCCTCTCCATCCTCAATCTCCTGCATCTGCTGCCTCGATGGC
TCTCGAACTCCTCGAAACTTGCACGATAAACATCGATACACTTCATTTGTCGGATCGACACTTGCTTGCTGAAGAGAAAAAATATTATAAATAAATACAA
ATATTTACAGTATCCGCTAATTCTTACTGAATTCTGCATGTAATCCTGCATCTGCGCGATTTCCGCAGCGATTTCCGTCCTTTTTCCGGCTCCCAACTCT
TTCCACATCGTCATATTCTCCTTACTGAAGTGTACACATACTGCACCACTACACAGCAGCCTCCCTCGCTTCTCCCCCACACTCTCCTTCATCTTAATTA
ACTGATCAGAAAAATGTATCTATAAAACAAATTGTTTGAATTTAATTGGCTAATACTCTTTCAAGTTTCATCCAATCATATCAGTCAATTTGCTCTCCAT
ACATTTCCTATCCTTCCAACATGGAGAGCCACTTCGAGCGAGTGCTGGCTGCAGAGGTCGCTCCTAAGCGACCCGTAGCCTCATTACCCGCTTCTTCTGC
GCCTAAACGTGCTCGTGTATCTCCTGAAGCAAATGCCGCAAAGATCAGTGCGATTATAGATGGCGCTGAAGCGCAAGAAGGCGACGCGTT