Description :
From Genome Similarity Track
Location :
Scaffold_3:9586- 12562
Transcript NameFunction/comments
Albla_Nc14004100conserved hypothetical protein

Sequence
2976 bases(100 bases per row)
TTACGAGAGACATTTGGATCCTATATGTGGCACATCAACTGGAGATGGGAATTCGCAAATAGCACAGAACTCGTCAAAATGATGAAACATATTCATAAGT
CTCGAATTGCAGCGGGATTTTGGGTTCTTGATTGGCACCTGCGTCAACGAAAAGACCAGATCCCCCATGGAAAAAGTCGCCAAGCAAAGAGCTATAATAT
GGCAGCCGCAGACTTTGGCGGTCGATATCAAAAGTACAGAAACAATGCAACGAATTTCAACAATCATGATGTCAACCCGCCTATATGGTCAAAACATCGC
ATCCAAAGCGCTCTTTTCAATGTGGAAAGCGTGACCTTTGGACGAGAAATACTGCTGGAGGATAAAAACGGACGTGAGCAATGTATTCTCCTGCAATATG
GAATGCTTCGCGTCTCTGAAACCCGATTGATCACGTCGTTTTGGATGGAACCTCATCATGGCGTAATGAAACCCATTATTCAAGATGATTTCTACCGGGA
GCTTCACAAAAATTTAGATCATGCGGTCGGTCACGAGCGTCCAATGCAAAAACACCAAGGAATATTGAGTTTGATTGTGTGCGTTCCGACTAAATCTCAA
GAGGAACCTAGCAATGATTACTCCACTCAAGGATCTCACATTCAAGAAAAAGAAGCGGATACAAAGAATATTGCAGCCAGACAGAGCCAAGCGAAAACAC
AATCACAAATGGATATATCAGACAAAGTATCAGCTACGTCGAGTGTGTACGGTATAAACCCGGAGATACCGAAGCAGGAAGTGAACAGGGCAATCCACGA
CGCTGGCCAGTTGTATTTATGCGAAAACGACCTGCTTCAATTGGTCACAGCATTTCTTTTTCATTGTGATCGCCAAGTAGTAGCGTCTCATCATACATTT
TCGATTCTTCGTTCAGCACTCAGAGGCGTTGATGCTCTACCCCAACCTAATCTGAAGTATCGGAAAATTGTTGGTGGAGAAAAGAGTGCAAATCAAACAG
AAGGAACGGCAGATAGTTCAAACCTTTTGATACCTCCTTTTAGTACAGCCAGACTTTTGAGCGTCTCCAATCGAGTGACGGATCAATTCTTGATGTATTT
AGAGCACGAAAACTTGGTAGCGGAGCTCGATTCTCTTGAGGTGGACCATGTCAACGAAATCGTTACTCATGAGAGTGGACCAACGAAACCACCTATGTCA
AGCTCAAACCTGCATCTATATACCATGCTAAAAGAGACATTGCAAAGTCTGAGCGATTTTGAGGTTACCTGGACGGACATAAACGGCGAGCTGGTCACCA
AGACATTTCGTGCAGAAGACGAGAAAGGCTTATCGGTAAATAGATCAGAGCGAAGTATACCATTGTGGATCACGTCGCATCTCAGTAGCTCCGCTTTTTT
GGAGGAATGGATCCCGCAGTACCAACTTAGTCAAGGACGATGTTTTGGCAAGCTCATCAACAAGCATGACATACTACTCTCTTTCCTGCCCTCATTGGAA
GTCATGGAAACACGCCAAAAACCGAAATATTCGCCAGCAGATCTAAGTGGAGGAGCTACCACTAATCGCAACGAAGGAAATTGTGCCCAATCCATTTTAA
GTGCAGTGGGTGCTGAGAGAAAACGAAGTTATAAACTGCGAGATTGGGACAACACTTACATACAAAAGACAAAGAAATCAACTTGTGGCTCATCTTCATC
GGATGATATCGTATTGTACTGGCAACGACGTCAAAGCTTTCGTGAAGACTATCAATCATGCCAAAATAATCGACATACTTGTCAGTACCACCAGCAGCCT
CCAAACCTAAAAGAAACTCCGTCAACGACGAAAGACCATGAACTATGTCGCAATTTTAGCCGTGAATCACTTTATGGAGCTGATTCTCATCTCCTGTTAC
GAACTAAAGACGAAAAATTCAGCACAGGATTCTTCCAAGTTGCATTCTATGAAATAGCCAGAAAATCACTTTCATATGAGCCGTATCAAATTGATCGACG
CAAGATTCAAGAAGCTGCAAAAGATGATGAGAATCAAGCGACTATATACTCACAAATTCTACCAAATATTTTTACAATTATCGATAGACCACCCAAAGAA
GACAAGAATAAAAAAAAGGATTATAAATTTCGTTCCGAACATCGACAAGGAAATGCACCAGCTGGGAGCGGCGATCGGAAAGATTTTTTGCAATCATCAG
CAGCTCGTCAGTTTCGGGAGAAGATGAAACGAGCACACGAGCACAATTTCTCCCGCGGTGTTTACATTTCTCTACGGGAGGGCACGTTGGTTCAACAGAG
CGATTTGATGCAAGCAATATCCAGTTGTCTTCGATTCCCCCTTGATATAGATATAACGGTCCTCCATCGCACTCTACAAGCTACCTCTACTCGCCCGGAA
CTATTTCAGTTGCAAAATACCTATCAAAAGCATCATACCACTGGCGTTTGGGATGAACTGATGAAAAGATTTAAAGAATCATTTATTCAAATTCTCTTAT
CAGACCATTTGTTCAAATCGATTTGTGGGACCGAGTATTACGTGTTTGTTGGCAATGAATCGATTTTTGAAGCTGAGAAAGTCGGGCAGGAGGACAATGT
CACCCAAGACAACGATGACAACGGTTCTGATTTGTGCTCTTTGGTCCAGACTGATGTTTTGGATACCTCGCAGCAATACAACGAAAGTATGAGCGTCTCG
GAAGATGGAACGGAGGATGGAGTCGAACACGATCATCTACAGGCTCAAATGAACGACAAAGCACACAGTAGCGAGATAGCTAGAGATGGTCAGACGGAAA
ACTGGAATTCTGATACTATGTTCAGGGGCGATTATTCGACACGCATTCAAGACGGGCGACAGAAAAAGAAGGAAGCTGTAGACCTCGAACTAAACAAAGA
CGTTGCGGTTGCTACATCCAACCTATCAATGCCGTTTTTTCTTCGATTCGAATACGTGGAAGTTGATACAACTACT