Description :
From Genome Similarity Track
Location :
contig_148:9585- 12015
Transcript NameFunction/comments
g13818.t1hypothetical protein

Sequence
2430 bases(100 bases per row)
GTTACCTGAAGAGTGCCCGTCACTCTTCCGGGTTGGGTATATGGTGTACCCAACACCACTCTGACACGTGGTGGTGGCCCACAGCCACCCATACATAAAA
CATATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGT
CAACCGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCCAGCGCAAGGTGCTGTGTGACTCCCGTC
ACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGT
GAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCAACACCTG
CCGAGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAACGGAAACC
AGTTCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGCTCGCTATGGAC
GCGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGTGAAGCGACAACGC
CTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCCTTGCGTG
CAAGCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAAGGTGACG
GTGTTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGG
AGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCG
ATGGACCTGAGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGC
GGTTTCCTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACT
GGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCG
GAGGGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGAC
GGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGTAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTG
CCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGTA
TGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGT
TCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCG
TCCACTGTGCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGACAGCGGTACCCACCGCTCCTGA
CTATGGCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCC
AGGGTCGAGGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGG
GTAACAAAGGACCATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAG
AGAGAACTCTCCTCAGGCACGGCCGGCCGA