Description :
From Genome Similarity Track
Location :
Scaffold_157:9585- 11715
Sequence
2130 bases(100 bases per row)
CGTCACAAATCTGTTGAGACCGGTGCGAGACTTAGCACCGAGTTACTTCGACGATGTATTCGTCCATAGACGGGCTATGGGCGGAAATGCAGACGTAGAG
GTTCATAGAACTCACGTTCGTCAGGTTCTTACACTTATGAGCAGAAATATCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCATTTCTTGGG
TGCATCGTGGGTAAACTCGGCGTACGCCCTGATCCTAAAAAAATTAGGACGATTATCGACCGGCCTGTGCTAGTCGACGTTAAGAGACTAAGAAAATTCT
TTGGTCTAGCGACGTACTTACACAAGTAATCGCGCAACTACGCCAAGATGACCGTTCATCTCTCTCGTCTCTTGAAAAAAGAACGAGAAGTGGTCATGGA
ATTCTGATTGTCAGCGTTCATTTAAGGTATCAAGCAGAGCTTGATGCAATCGCCAAGACGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTC
ACGCCAGCGATTTTGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACGGCGCACAGCGTGTCGTCTGTTATCAATCGCGTCAGCTGCAAGCAGCTGA
GCGTAATTATCGAGTGCATGGAAAGAAACGCTTTGCCATGAAGTATACACTGGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCCGTTTGTAGTCTA
TACGGACCATGCGTCATTACGCACGGCCGTAGACAGCCCCCACCTCTCGCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTTTCCGTG
GAGTACAAACCCGGACGACTTAATGTTGTCGCGCCACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATAAAACTGTTGCAACGCTAGTCA
CTAGTGTTCCGTCGACAACATTGCTTGACGACATGAAAAAGTTCTATGCAGTAGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCG
TAAATTTCTCAAAAAATTATCGGCCTTGTATCGGTCTTCCGCGGGTCGATACACAACACGCAACGAGTTGCTGTATTATACGTCCGTTAACGGCAACACA
CCTCGTTTCGTCGTCCCCACCCATAATGATTTGCTATTACGCATCATGTATGAGTGCCACAATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTT
ATCTCGCGGTAAGTCACGACTTTTACTGGCCCCGCAGTATCAGTTTGTGCGCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGA
CTTATATTCAGACAGAACGCGTCAACCCCGTTCTCGAAGAGATCCTTCAAGGATACGTCCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGCA
GTTTGCAATCAACAACTCCATGCATGCATCGACAACGCATACACCATTTTTCGTGAATGGCTTACGCCATCCACGCCTACCCACCCATTCAGAGTATGAC
ACCAATTCAAGGGGAGGAGGGATTTGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTGTCAAGGTAATCGACGACGCGAACGTTGCCGATGTCG
ATCAAGTCGAAATCGAAGAAGATAACCTTATCAATAGTGATGACACTATTTCTGACCCGGATGAGGATGATGATGCTGGTATATTCAGTATCGCCAATGA
ATACACCAGCGAGGATGAGAACACCCTCGCTAAAAAAAGAGGATGACCTCCTAGCGGGCACGCACAAGGCGCACTGCAACAAACCAAAGTGATTCAGCAA
AAGATTTCCTGCTGGCACGAGAAGCAGTGGTCCATTTCGTGCAAGACTCCATCGCTAACGCGGTAGACCAGCATTAACAGAACGCTGACAAACATGGAAG
AGCAAACGTTCTTCTATTTAATGTAGGAGACTTAGTCCTACTGTCTACCGTAAATATACCTAAACACGTAGTAACTAATGTGGGTAGTAGTATACTACTA
CCCAAGTACATCGGCCCGTTCCGTATACTACATCGCAAAGGCAATGCGTACACGATCGAGTTACCTCGCAGGATGCGTATGCATCCCACGTTTTATGTCG
GTCGTCTCCGCCCGTACCATCATCACGAGG