Description :
From Genome Similarity Track
Location :
scaffold_17:958347- 959982
Transcript NameFunction/comments
Plaha_PHALS_11233hypothetical protein

Sequence
1635 bases(100 bases per row)
TAAATGATGGATATCTCATCACCTCATGTGGTACAAACAGTATCAAATTGACAAATTTATCGCCTTCAATTTGTTGCACGTACACCCAATATATAATCGA
GCTCTACAAGAGTTTCAAATATGAAGCCATGTTATCTTGTTTACCTCAGCCACTCCgcctacagttgagccaatGTTCTTACCACACAGCCGCATGACTT
CAGTGCTACGTAGGTGGATACGTGACTAGGTGTTGCTTACCACCTAGTGCGTTTCCTCCACGCCAAGACAAAGGTAAATGATCTATTATAACATCAGAGC
CTGGATCTTGTACTCGTAAGTCTATATCGATATTTGTCGAGAATAAGTCCCAAGGTTTCTATGATAAATCTCTGTGGAGACCTTGGAACTTATTCTCGAC
AAATACACACCCTGAAAACCGTAATAAACAGTCGCTCTTTCATGTCTCAACAGAGATCCAATGAAGACACCGGCTCAAATATTGTAAATTTACATCCTAA
ATAGACATGCCTCTTTTTCAGATTTCGACCTTTTTCCGACTCAAGTCTTCGTCCTGACGCTTTATCGTGGTACATCAATTTGGTACGTACGAGCTTCAAT
CTGAATCGTAAATATAAAAGAGCTAATAGTCAATGTGCACAAACATCATACTAAAATTCGTATCTGATTTAGCTATCCTTAACTAAAAATAAAGCTCACT
GGAGTCAAAAACCAATATGTTCGCCGACCATTCAGATcacgaagatttttttttgtatcaTCCTGGCTACGCACTATCCCGCTCGCTGAATGTTGTCATC
GCAGATTATGCTGGTAACAGACCATTCTGACCGCAACTATACTAGTTTCCAATTTCGTGTTTGTTGCTTTTGCTGTTGGCAGACCATCCTTGTCACTGAC
TATCCTTGTCATTGACCATCCTTGTCTCCTATGCAAGGTCCTGGCTAACCGTAACTTTTACAAAAAAGAAACGCGCCATACTCGGTTGCGTTGAGTGTCA
GCTTCCCAAGCCATCATctcattaattttttttgcaagtTGAAATCGCATAGTCCGAAGAGCACATTGGAGAAACGCGGTTACTGAGGCCGTCATTAAAG
CCAAAATCATACGGGTCATGTTTGCGATGTGTTTTTTTGATCAGACAAGCACTTCTTCATATTCCAACAAACCATTTTTACCTTTTTTGAAGGATGCAAG
ATTAGCCATCGTATTAGTAGAAGCCTCTTCAGCTTCCGTTACACGCATGGTGCCCATCTCTCAAAAAAGAGTAGGAAGACATTCCGGTACGATAGGCTCG
TCGCTAAATACGATAAAGCATCAATGCCAACGACTTCCACTTGCTCGTAAAGCAATAGTAATAGTGTGATATAGTCGTCAGTGACCATACCAGAGATAGT
GTCTCGACAAGCAGTCCTAATGGGTCAGAGTCAAACAGATGCATCGCTCCATGTTTAGCACTGCATTGTACAGCTACGACTTCGATATTATGGTGGGTAC
ATCTCCTTACCCTCAGTCCGTGCTGTACAAAACCATATGTTTTTCCATGAGCCTGTTGGTTTAGCTACCGACCAAGTCTTGAACATAAATAAAGACGGAC
CCAGCTTACGAATATGAAGCGTGTTGTGCTGCGCA