Description :
From Genome Similarity Track
Location :
Scaffold_76:9581- 10605
Transcript NameFunction/comments
Phyra_82684Hypothetical protein
Phyra_82685reverse transcriptase

Sequence
1024 bases(100 bases per row)
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGT
AGCTAACAGAACTAATGAACCAACTTCGAATTCATTTGTGTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATC
TTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCG
GCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCTATGACTGCGCGCAGTACGTGCGCGAGTCGTTA
CAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTCGATTTAACCGGATACCCTCCCCCACTTAAGGAAGAAGCTACCGCACCGAGTACGCT
CGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAG
TCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAG
TCGACATGGACAGCTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACC
ATGGTGTCTAAACACCATGTCGACAAACAAACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGGTACATCTTGCTGAAGCGGTCA
ACAAAGACCACTATACCAGTCCTC