Description :
From Genome Similarity Track
Location :
Scaffold_1374:958- 2367
Transcript NameFunction/comments
Phyta_totarag12825Crinkler (CRN) family protein

Sequence
1409 bases(100 bases per row)
CTGGCGTCCATGGGGCCGTATTGTCATCTTCCATCGCGAGAGTCTCTCAGAGGTGAGGTGTGCCGCCCGTGGACCATGTCGAGCTGGTGTTCCCTCCTCC
ATTCGTCGCTGGTGTCGTTGCcggctgcgtcgtcgcctccCCCACTTGAGCTGGCGGGCTGTGAGTTGCTGCCTTGCTTCCGCAGCCCCGGCGGCAATCC
CGTCGccagggggggggggcgatCGGCCGGGGGAGGGCCATCCGCGCCATTCATTATAGCTGGGTAGTGTGTTTGCGTTCCAGGCAGTGCAAATGTTCCT
GCTCTCTCTTGGGGGAATTGCGGAGTGACTCCAACCACTCCTACTCAATGCTGCTATAGTACCATTAACCAGTTCATTTCCAGAGCATTTACCGCTATGG
CGGTGAAAAACACTAACCCGATTAATCATGCTGATCCTTAGCGTGCTATTTCTTAAGTGGCAAACCCAAGGTCGGGAGGTTCCGGAGCCGCGACCATGCG
CGTGGGTGCCAACTGCGAGGAGTTGGAACCCCCTGGCTGCTTCTGCGCTGGAAGTGATGCCCCCTGCTAACATTTTTCTATCGCGATTTTCTCGTTTTTC
TCTTCTGATATTGACTGAAAGGTGATCCACCGACTCGAGGTGAACCACAAGCGACATCCACCTAGATGATCAGTTCTAGGTATTTATTAGTGACTGGAGA
GGGCTTTGTACGCGCTAGTGTCGAGATCTCTAAAGTCTACGACTTGAAGTTGCGTTATGAGAGGACTATGGCCAAAACCCGAAATTGACGTGTATTTTTG
TCAGATCTTGGAGGTTATTAGATGTTGAGATGAATGCTTCAGTGTCGAacccaccagcagcgctttGGTACACTGTGCCGCTTGAACAAACATCCAAAAC
TTCAGTAAAACGTCCGATCAATGAATGTACACTCAGGAAGGTGTTATTACGTGTTTTTAGCTTAGAACGTTTATACGTCCGTTGCCAACACTGATATTGA
TGGTCACCAGAAATACACTTGGTTGAACTATGCTTTTCTAGAGCGCTGCACTGTTTGTGTAAGTCTTTGAAAGCAACTGGCAACTACTTCTGCAGAAGGT
CGTGACCGATTGCGTGGTAGAGGACTAACTATCTGGGGTAACCGCACGAGTACCaaacgacaagaaggacgacgcggTGTAAAAGTAGACGTTCAGGAGG
AAGTGTATGGCCACGcttctgttgttgcttgcgACGCGATGTAGAGATCCACAAGGCGACTGGTTAAGTCGCGCTCTGCTAAACACTCATGTGCGTCAGC
ACCTCCAAAGACCCCGTTTCCATTGCGACGACCAGTTTCTTCCGATCTCCGGCCGGCTGGAAAACCCAATCGACACGGCAACTCTGGCAATCGATCTTGA
CGCAGCCAA