Description :
From Genome Similarity Track
Location :
Scaffold_898:958- 12645
Transcript NameFunction/comments
Phyta_totarag11239hypothetical protein
Phyta_totarag11240hypothetical protein PHYSODRAFT_561927
Phyta_totarag11241hypothetical protein PHYSODRAFT_354944
Phyta_totarag11242NADH dehydrogenase
Phyta_totarag11243hypothetical protein
Phyta_totarag11244hypothetical protein
Phyta_totarag11245hypothetical protein PHYSODRAFT_346938
Phyta_totarag11246conserved hypothetical protein
Phyta_totarag11247hypothetical protein PHYSODRAFT_302895

Sequence
11687 bases(100 bases per row)
TGGGGTGGGTAGcccggctgctgctgcgggtaTCCGTGCGGGGGCTGGCCACCTCCTGGATACATCTTGGTTTGGAGCTCTAAGGGGCTGGTTACGCTTG
CGAAGCGTCGAACGGGATCTCGAGTGAAGTTGTGCTGACGTACAGTACCGTCGGCAAAAGGGGGAATGACTGAACTGAAACCAAGTTGTACCTACCTCGA
TACGGCGCAGTGATTGGCTGGTCCTCATCCGTTCATTGATTCGTCTAAAAATACCTTCCGTATTACAACCAATCGAAAGAATCGTTGGTTTTTGGTCCAG
CGGACGAGTCGCGACTGccgagatggcgaagatggcgacgctGGGAGCGCGCTGCGAATTGCTGTCCTCAGGGCCCAGCGGTAGCTTACGCGCCAGCATC
AAGCGGTATGGTGAGATCGTGTACATTGGGGCGATCGAGGGTCTCCCGGGCGACGGATGGCTGGGCGTACGGCTGGACAAACCGCTGGGCAAAGGCGACG
GGTCGTTCCAGGTCACGCGCTACTTCGAGTGCAAGCCGCTGCACGGCGCCATTGTGCGGCCGGAGAGAGTTAATACACAGGGCGAGTTCCCCATACTCAC
GACGCACGAGGAGAGTCTGGCGCACGCTCTGGAGGAGCGACGCAAGGAGAAACAGGGGGCGAGGAGCGCCCGTGTCAATGCTGACGACACCTCGGAGCTG
CATTGCGAGCTGACGACTGGTGAGCTTGCGACGGCGTTCTGGGTGACGTTTACAGAGCAAGAGGAGCATGTGCGCAAGCAGGTGGGGCTGTTCTgtgagc
agaagaagcagccgCTGCCTTGTGAACCGGCCAAGGAGGTCAAActggacgcgctggtgcTCAGGGTGAACGCCATgagagatgctgctgctacggcAGC
GTCGCTGTACTTGTCGCCGTATGATACTCGCCACACGCAATTAATTCTGTCtaagctgctggagctcattgATTCCACACGTACGACTTTTGCTCCAAGG
AAAAAGTTTGCGTTCCGAGCTcgtgctgcaagaagcgctaAAGCCAAGGAGCAGAACCAACCAGAAACGGACGGAtcctctgcttcagctgacTCTGCAG
GCAATCAGCAGCCCCCGTCTACTACGCAGAGGGCGACGGAGTTTGACGAACTCGTGCACGCCAACAAGCAGAACGAGGTGATTGTCATcgatagcagcag
cttcactgACACAAACGACAGCAAGCGCCGCGACCTCAACTTCTCGCATCTGACCAATTGTGTTGTGCTCGTATGCGTGGAGACGTCTGCCATCCGTGGT
GATGCACTCAAGAACTGTGTGTTCTACTCCGGAGCGATCTTCGGTAGCTTGTGGCTTGAGCACTGCAACGGCTGCGAGTTTTTCGTCGCATGCCGCCAGT
TGCGCGTTCACTTGAGTACTGCTACGACCTTCCACCTGCGCATCCCGAGCCACCCCATTATCGAGGACTGTCAGCAGATGCAGTTTGGGCCTTATCGCTT
GCAGTTCGACGGACTCAAAGCTCAGCTCGAGCGCTTGGGATTGCAGAAGGATTCTGGACTCTGGGCGAAAGTGAACGACTTCAAGTGGCACAAAGCGCAG
CAGTCTCCAAACTGGAGTATTCGCGACCCGAAACAGGAACTGCCGAAGATCCctgcagagctggagaagctggttTCATACGACTAATCTGCAGTCGACA
GCTGGCTACTGGTAGCATATTTAATGAACCAACGCTAGGTGAGCGTGCATGCCCAGACGTGGCCAGACCGAAGAGACAAATGCTCTTGAAAGTATATAAA
CACATGCAGCTGGATACCTGTCATCCATCTATCATCTCGCCTAGCGCCATCCTCCCTGTTAGTCTAGTcgtgcttggtcttcttgtgttttttcttcttc
gcgtccttgtgcttgtgcttcttaGGTTTCACCTCGACCTCTTCCTCGGCTTCCACGGGAGCCGCTTCCTCTTCTACTACTTCCTCCTCAACGGGCTTGT
cgtgcttgcgcttcttgcttttcttctccttcttgtcttccttctccttcaccttcttggccttcttttCCTTGATCGGCTTAGTCACCGGCTCTCCTGC
TGCCAGGTTGAGGTGCGTAGCCTTCTTCGCCGGGGAAGGCTTCACGACGTCAGCGCCGTCAAAACGCATCGTGGCTTCAATAGCGACCATGCCGCCAGCA
ACGTGGACTCTGCTCAGCAAcaaaacaacagcaacacggtATCAGCTCCATGTACTGCAATAACAGTATGTTCCACGCATCAGTCAACCAACTTACCGCA
GCACTTTAACTTCCACTTCGTTTTCCACAGAGATGGAAGAGCCGTCCTCACCCAGCCTGCAATAAgagaagaaaagaaaaaaaacagcGTCAATAACAGT
CAATTACATAGCAATCTACCGCAGCAGCATACCAGCAGTCCTGGGCGTAGTTGTGCACGTATCCCTTGGGCAGTTCAGCCTCTGCCACGGAGCCGTTGAA
GACGCCGGCGAAGAGCATGCCGACATGGTTGCTGCCGATCTTGTTGACGACACCGCGTAGCCGCATGCCCTCCTTGGGGCGGAACACCAGCGCGTCGGCC
AGCACTTTGCAGTGGATGAAAGGCATCTCGTTCACGATGGCGCCGTACGGCCGGTTCAGCTGCACGTTGCTGAAGCTAAGCACCACGCCCTGCAGCGGCT
CCGAGTAGTGCATGAGCTGCTCCGTCAGGTCCTGCTCGATGCCCACGCGCGGCTCCATAGCGTGGCATGGCGACAGACTCACACTGTGCCGCACTTTGCA
CAGCACGAACGCGTTCGACACCATCTCCACAGCGCCCAACACCAATACTCGCTTTGCCACCAACAGGTAAATGTCTTCGCTTCCAATGAAAAGCGTCAAG
CCTCTTTCTGTAATTTCGTCAAAATTCGCACATCTCTTTTCGACCAATCGACGCAGTTTCAGACACTGCGCAACATAATATCCTACAAGCAACGTAATAT
ACAGTTATGTTGCCTAGAAGTTGCTTGAGCGGTCAGAGAAGGAGAGCCGCTCGTCCTGCTCCCCACACTACCGGAACGCGAAGCGATGAACGTCCTGATG
CTGCGTCGATCGGCCGCGGCTGTGGCTGCCAAGCAGAGTCTGAGTCGTACAGCTCCCGCCGCTGTGGCCGGCAGCGCGCGCGGGTTCGCGAACGTTCCTG
AGTCCGGCAAGCTGGACCCGAAGCCCACGTGGGGCGAGGTGATCGAGAAGATGTCGGACACCTTCTTCCTGTCCGACGTGTTCCGCGCCACTTGGCTGTC
CTGGGAGGTGCACGTGGAGCGCAAGGTCACCATCAACTACCCGTACGAGAAGGGCATGTTGAGTCCGCGCTTCCGTGGCGAGCACGCGCTGCGTCGCTAC
CCGAGCGGCGAGGAGCGGTGAGTGCATTCTGGTGGTCCGGACAGATGTCGGAAGAGGCGGATGGTTTCTCATTTTTTGTGTCTGGCATTTGCTGTTGATT
GTGGCTGGTAGATGCATTGCCTGCAAGCTGTGCGAAGCTATTTGCCCAGCCCAGGCCATTACCATTGAGGCGGTACGTGAAGGAGTGTTAAACGGCTTGT
GTGGAGAAGATACGTGGTCCTGATGTTTTTTTCTCGCTCGGTCTTTTATTTTTCAGGAGCCGCGTGCGGACGGAGCCCGTCGTACGACGCGTTACGACAT
CGACATGACCAAGTGCATCTACTGCGGTTTCTGCCAGGAGGCTTGCCCTGTggacgccatcgtcgagGGCCCGAACTTCGAGTTCGCCACCGAGAGccac
gaggagctgctgtacgacaaggcgaagctgctggccaacggCGACAAGTGGGAGTTTGAGATTGCCAAGAACCTCTCGGTTGAGCAGCTCTACCGTTGAG
CAGGGACAGACAGACACAAACAAAGGGAGGTCCTGCAAGGTGTGAGTTGTGAGATCGATCCTCTGTGAGGTAGAGCGGAGCGCGGATTGGTGTAAGTTTG
TAGCACCAGCCTTGCCTGACTGCCTGCCTCCCTGGGGTAGACGAGTGGGATGCCTTTATAACAAAGAAAATAAGAGCGAGTGAATGGAGTTTGAGGCTCT
TCAAGGAGCTGTCGCGGGCGATGCTTCAAGAGAACAGCATCCAGCATCCATCTCTTTCCAAGTTCTTGTTTAGATACAGGTTCATGTACAGAGGATGCAC
TGAGGTTACtacgtctacatgtagacgtcTTCCGGCGGTGCGATGGTGAAtttgatcttcttgatggtcTGGCCTGCGAACTGGTACGTCTTGTCCGGCA
CTCTGGACGTGTCCGTGTCGTAGAAGTAGCTCGTGCCAACCGTTTCCTCGAGCTGACCATGCAGTACGTACTCTCCGATTCTCAGCATCGGAGTCGCTGT
GTCGATGCCCTACAGGAGTCAGCAAATTGAGCATGCAGCACAATGTCAATCTCAAGACTTGTCTGCCGTCCTCCAGAGCACGCACCTACCTCGAGCGTCG
CCGAGCTGTAGTCGTCGAACAGCGGGTGGTTTTTGAAGTcacacagctccagcactaccagcgtctcctcctcttctccaCTCTCCTCTTTATTCTCATC
ACtgtctccttctgctgctgcagagtgtgCAGCAATCAAGGCTGCAGccttttcctcctcttcgtccgaTCGTCCATTGCCattcacctgctgctcaccC
ATCGTCACTTCAACCTCCACGTTGTTCGTCTTTGtctcttcttgctcgtcTCCACTTCCCACCGACCGTCGTCGCTTTCCCGTGGTCGTAGGCGAGCGCA
CAGCAGTTTCCTCCATGGTGCACGCAGCCCAGTGACATGTCCTATGTCACTACAAAACACCTCGATAGAGTGCCCTACATGTCACTAATATCATCATTTA
CCTCGATCGAGTGTCATACATACTCCGTGACCAGCCAAAAGTCAATTGGCAGTTGAGTGCACCATGTCCACGACGTACGGCGGCCTAGCAGGGGCTTCCA
CGGGCGAGGAAGCGACCATTGTTCTGTCAGGTATTGGCAAGGAGCTGTCCGATGGAATGCTCACGAACATGTACCGCACCTATGGCCCCATCGTTCGCGT
CAGACACAATGGAACCAACTCGGCGTACGTCGCTACAGTTAGCATTAGCTTCAGCTGCGTTGCATGCGTGGCTGCAATGTCCTTATTATACTAACTCATT
GGGTGTGTGTGCAGTCAGGTGATTTTCGAGCAGAAGAACCACGCGATGAAGGCCATCAAGGCGACGAATGGCGCCGTGGTCTAcggcaagacgctcaagg
TCTCGCTCCAGCGCAAGTTCAAAAAGACGACGGAGCCGTGTCGGGGTTTCGCAGCCGGTATCTGCCGCAAGGGTGACATGTGCAAGTGCGTATTATACGT
TGATGGTATTTGCTAGTGCTGTGGTGCCAATGGGTCTAACGATTGGGATTCGATGTGCAGATACTACCACGTGACAGACAACGCGGCTTTtgcggctcca
gctcctccttccGTTGCAAAAACTCCGCGTGAGCCCAAGAAAAAGGCTCCGGACCCTGCTGAATCAGCTGTTGTGCCGCCGGAGATTCAAGCGATCCCAG
ACACGAAGGTTTGCCGGCATTTTTCGCGTGGCTACTGCTCGCAGGGTGCGGCGTGCAGGTTTGCGCATGTCTTAGGCCTCCCGAAGCAGGCCGTGCCTGC
TCCTACCGGAAAGGTTGCGCAGCCTTGCCTGTTTTTCCAGAGTGGCGTGTGCGCTCGTGGCGACGCGTGCAGGTATGTGCACGAGCCGAAAGCGGATGCC
ACCCCGGTGAAGTCTGCTGCAACGAAGGCGGCTGCCCAAAGCAGCAGTAGTGATGATGAGAGCGAGAGTGAACCCGAACAGAACAAAGAGACTCGCACAT
GTGTCGAGTGCGAGAAGCCTGGCGTGGCCGTGTGGAAATGTGCGAAGTGTGACAACTCACTCTACTGTGACGACTGTAATTCTGCGGTGCATCGTGCTCG
CGTGATAGCCAAGCACAAGCGCACAAAGCTTCCGTCGGTGCCCAAGTTGCCGCGCTGTGGAGAGTGCGAATCGAAAACTGCTAGTGTGCGTTGCGAGCAA
TGCGAAGTCCCATTCTGTGGGTCTTGTGATGCTAGCGTGCACAAGTTTAAGAGCTTGCGGAAGCATGTCCGTGCCAAACTATCGGGCAAAACGGAGAAGG
TAACGTCTAAGGCCAAGGAGCCAAAGCAAGAGCCCAAGgttgccaagaagaaggaagagaagaaaaaggAAGTTCAAGTAGTGAAGTCTGCGCTGCAGGC
CAAGGTCGTCGACCCTGTGTCTTACGTCGAAAGCGTACCGCAACTCGCGTTTTCTAGTGATTCAGAGTCGTCCGAGTcagaagacgaagagatgGCGGAA
GCctccgatgacgacgagccGATGCCTGCAGCTGCTAATTCATCAGAAACGGAGTCTGACGAGGATTTCGACGATGTCAAGCCGCAATCTTCGGCTTCAG
TGGACCCCACGCCTGCCGCCAAAGAACAGGCCCCTCAGTCGTCAGAATCCGAGTCTGAAGACGATTTCGACAAGCCCGCTGCTAAATCAACACCATCACC
TGCGTCTGTGCCGAAAATGGAGTTGTCATCCGATTCTGACAGCTCCGACGATGAATCCCCAGAACCAACTCCAGCGCCCAAGGCAGCCGAGTCTGAAGAT
GATTCTGAGGACGAAGCCCCTTCCAAGCCTGCTGCGAAGTCCACACCAGCTCGTAAGCCTACGATGGCGGAACTATCTTCCGAATCTGAAAGCGACTCTG
ACGATGAAGCTCCATCCAAACCGGCTgtgaagcagacgaagaagccagCACagaaggctgctgctccggcaGAATCGCCTTCCGAGTCTtccgaagatga
agctccGCCCAAGCCGGCGACAAAGACAAAGACAAAGCCGACACCTGCCCTCAAGGCCGTCGTGAAAGATGCAGCTTTGACATCATCGTCCGAATCGTCG
GACTCTTCAGACTCTTCCGAGGACGAAGCTCCTCCGGCTAAACCTACTGCCAAGCCTACTCCTGCTCCACGTCGTACTCCGGTCCCAGCACGCAACGACA
AGGCGGGAGGCATCTCGGATGGCAGCTCGCACACTTTggtcaagaagatcgaggcTTTCAACGAGTCGGGTGAAggcgacgtgctgcaccTGGACACTAA
CCTGAACGGCTTCGAGCGGCTGCTGGCACACGACTGTGCCGAGCGCCTTGGTCTTGCGCACGAGAGCACCGGCTCCGGACTCGAGCGTCATATCATTATC
TCGCGCCATGGTGCGAAGCGTCCTGCTGCGGATTCTGGCAATGGTcacaagtccaagaagagcaagcaccaccaccgccactGAGTAACGACGTGCTCGC
GGCAACGCCCATGGTCAAAGAAGGTTGTAGTTAAGACACCACTTCGTTAGCCTAGTGACACCGAACAGCTATAATAGattcctcttcctctccgTGTTCA
TCTCTCGCGCTTCGGGTTCCTCAAAGGTTCACGAACGTATCTCACAGTTCCAAAGCCAACGAGAGCAGCTCGCACCAGAGggttctacatgtagtgtcaT
AGCTCCGGAGTGTCCAATTCTTGCTCTAACCTTTCCCCTCCACCATTGCTGAAAACTGTCCGTCTGAATGACCGAAGTGTCCGCCGAGCGTCCTaagcga
ctgcgactgcagaCCGACAGCACCCTTACTTGCGAGCGGCCCGTCTGTCGGCACGAGTAGCAGCGTGGAAACCCGAGCGGATGGCAGCCACGGACCGCGA
GGACCCGCAGTCCTGGCAGTGCACGAAGTAGAGACGGCTGACCGAGTCGCGCGTGAGCGTGGTGTTGGGCGAGCGGCACATCTGGCACGACACGTACTCC
GTGATGTacttgcgcagcagcgactcgatgTACTTGGGCACGTAGCGGCCACGGATGACCAGCCGCTGGTTGCCGTCGATGGATCCTTCCGTGCCCAGCT
CGGCCAGcgtgaactgcagcacgtgctcaGGGCTACGGTGCATCATCTGGCAGATCTCCTGGAAGTTCACCcacagcgtcttcttggtgccCACGCGCAT
GAGCTGCGGGGGCTTCATCGTGTGCCGCTTGCGGTCCGTCAGCTCCGGGTTGTTctcgtgcagcttggccatgatgcgcgccagcagctcgtccttgtAC
GAGTACGTGGCGGGgtcctgcaccagcaccgagtTGGCATCGGGCGCGGTGTCGGCGGTGGCCACGGTGTCCTCGgacttgtccttcttctaTTAGTTTa
ttattatttatttataATACATATAAATGATTACTCAGTGttagtaaaaaaaaaaaatacctCGAGGATTTATCAATTGCCTGCAGCGCAcgcacctcct
tcttgaccttcttggacttcttcttcttcttcttcaggtcgaACATGGCAGCCACGTCCTCAGGAACGGCGGGCGGGGCCACGGCGGCATCGCCCACGGG
cggcagctcctgcttctcggCAACGTCGGCCATCCTGTCTCTGATCTTGTACTCCCCCTTTTCGGCTTGGCTGGTGCGGGTGACTTCTTCCGAAATGCTC
GAGTTTTCTGGTGGCTGCGCGATTTCAACGAATCAAATAGCGCCAAAAAGAAGGTTTTCAGCGAATCGTGGATTATTGCTATTTGACGAATCAGATGTAG
TTATTGCGACAGTGTTTTGGCCAGTCGCAgaacggagctgctcgtgcctCACACTCGACCGATACTTGTGGACAGCAAAGGCCcctgcagctgaagatgg
cgacgcGTATCCCGATTGCGTTCCGGCGTGGCCCgcgcaccaagaagaaagcgatCGACCTCGTCAAGACCTGGCACATCTTCCGCGGTGACAAGGTGCG
ATTCTCTCGCTCTCTAACGCACAGTATTCGCCGAGATATCGCTCTCTAACTGTAGTTCATTGCCTCCCAGGTCGAGATCATCGCTGGACCCCATAAGGGC
ACGCAGGGCGAGGTCGTGAGCGTCGTGCGCGACCTAAACAAAGTCATCGTGGAGAATGTCAACATGGTGCGCGCCGGAACGAGGCTCTAGAGGCTCTAGA
GACGCCAGCAGACTGACTgactttttgctgctgtgaacAGTCCCACCGCTACGTCAAGTCGACGCCTGCCGCCGCCGGCCGCTCGTACCTGTCGCCGTCG
CCCATCCACTACAGCAACGTGAACCTGGTGGACCCGTCCATTGGCAAGCCCACGCGGGTCGCCATCCGCTTCACGGACGAGGGCGAGAAGGTGCGCGTGT
CCAAGAAGACGGGCACCATCATCCCCAAGCCTGCCGTCCTCAAGGAGCGCCACAACCCGCGACGAACAGGTGCGTTGCTACAATATTTAGTCGCCTCAAT
TCCGTGGCTGTTGTGCTGTCCGTAGCTGACAGACACTTTTTgctttcgtcgtcgttgatgtTTTCTTCTTTCAGAAACGGGACCTTTCGACACGATGCCC
GAGGATGTGCTGGAGCGCACGGTCGAGGACTGGGAGGTCACTCGTCTGTAAGCGTCACTCAGCTCCGATCCATTGCGAGGATGATAGTCAGCCATGTAGG
AGGAAGTGGGTGCACGAAGACTCAGTCTCTGATTGCAATTTCCAGCTTTCATCGCAGGGTTGTGCTGTATTTCGGCAGTGTGGCGATTGCGCTCAAGATA
AATGATAGACACCAGCAGTTTGACGATCACTGCAATCCGTTTCCACCTATTTCCGTTCTGTCTAAATGCAGCGTACTACTACAAACCGTTTCTGACTCTC
TGGCTGCGCGTTCATCTGCTCAGAACGCGAGTCCTCACCGAGGCTTTGCGGCACAACAACACGAGCAGTTTCTTCTGTTATCCATTCTTGCATTTGTAGC
TTGGGGCGCAAGCGCGATTGCGATCACTGGAAGCAGAGTCGAAGTCTCATCATGTCCCTGTCGGAAAACGAAGAGGCCCAGCCCCTTACGGCCAAAGATC
AGCCGCTCTTCGACGCTGTGAAGGCTGAGTTCGGTGACCGCTGCACGGACGACCTTGCAATCCGTGTGACTCGCGCATATCGCAgtgtgaagaagaaccg
GCAGCAGTTCACGATCTCCGAGACGAAAAAGATCTTGgacgctcgtgctgctctcgatATCGACAACGTTCTCAAACACGACTTGCCCATGTCCAAGATG
TACAACGAGTTCTGGCCGACTTACATCTACGGTGAAGACAAAGAGGGGCATCTGGTCACGGTGGACCGCCTCAGCGATATCAACCCCGACGGTCTGTTCA
AGACGTTCGCGAATGTCAACGACATCATTCCGCACCGGTGGCAGTACATGGAGCGCATCCAATGGGAGAAAGTTGCCATCTCGAAGCGACTTGGTCGTCG
TGTCTACAAACACGTGTGCATCGTGGACCTCAAGGGCCTCAGCATGAAGCTCCTGTCGCCGTCGGTGTTGAGCCACCTCAAAGTACGTCGCTTTGCTTAC
CGGTATATCCTGCACTTGGGGCAAAACTGATGTGTATTTTTCTCTTCTGTAGCCAATCTTCGACGTGGGGCAATTCTACTACCCAGAGACTCTCCACTGT
CTGTACGTTGTGAACGCACCGTTCATTTTCTACAGCGCCTGGAAGGTGATCTCGGCGATCATCCAGCCCGAGACGCGTGAGAAGATTCAAGTGTTTGTAT
GTGACTTGTGCTTTCATGAGATGCTTGATGGTGGCAAATTGTACTGAATCTGAGACTTGTGGCTTGCTTGATGATAACGCAGAAAGACATGAAGGCGTTT
CTGGAGGTGGCGCAGAATCACGGTATcccgctgtcgtcgcttcCATCATACATGGGCGGGTCGCACCCGGGGCGATCCATGAACAACACCTTCACGGCAT
CGGAGCCAGATACGCCATTCCCTGTTCCAGTGGTCGCAACGGTGACTACCGAGAAGACGGTccctgctgaagctgctgccggacTGGAAGTGTGTGCTGG
AACCTAACGTGTTGTTCGAAGGAGGAGGTTTTTAGCAGCATAATGTAAACGCATTTCCATTCAATGCCCACACCACGTACGGTAGTTGTTCCTGTAACGT
TGTATGCTTTCACTAACTGTTGCAGATCGAAGGATACCCGGACAACTCGCAGTCTTCCGACCATAGCTGTTCAAGGGGTAGCGGATGCTCTGTCGAAGAG
CTCTTGCTGTACTTGTTGATAGAAGAACTGCATGGCTCTAGACCCAACCAGGCAGTCGCTCCTCTCGACAAAGTCCTGAGCGCtttggagctgcttggag
cTGGCGCCGATGAGCAACGAGCACGCCAGGGTGCTACACATCGCTGCCCCGCTAAGCTGAAAGGTGCTGTCAGAGTCGACATGCACGTGAATGAGTCGGC
ATCCGACCGTGATATCACCCTCGGCACCATTATCGTCGTCCTGCTGTGCCACGAGGCCACCGTTGCGAATGATCTGAACCACTGAAGCAAAGGATAGCGA
CTCGAAACTGCGGACGAACTTATGTTTGGCCTCTTGCTTGGGTGTTCCTAGCGTCCACCGCACCACTCCGCCCCACAGCTGATAGAGCTCGAGCAACGTT
TCCTGCGAGACGCTACGCGAGTAGCACGACGAACGGCAGGTTTCGAGCTCCGCTATGGTCCACAGAGGCATCACCAACATTAGAGTG