Description :
From Genome Similarity Track
Location :
Scaffold_74:95793- 96911
Sequence
1118 bases(100 bases per row)
CCTCCAGACTACGCAGTCGCTGCAAGAGCTCACGATTCGACTGCCGCAGACTACTCGCCGTCGCCTCGGCGTTCCGAGAGCTCTCAGCCGCCCGCTCGGC
CTCCTCCTGTGCGTCCCGAGAAGTGTTCAGCGCCTGCTCAACGTCGTCCTGGTCAACCAGGTCGCGTCGAATTCCACCGCGACGGTCCTCCGCCCATCGT
TGACTCGAATGGAGATACGTGCTGGATTGTGGACCGTATTGTTGATCACGAAGATCCTCCCCGCGTGCGTCACTCGACCAAGTCGTCGGCTCAACACGCG
GCTCCCGCCGCGCGGAAGTATAAGGTACGATGGCTCAGGTTTCAACCTGCTGATGATACGTGGGAGCCTCGCGCCAACTTGCTTCGTGACGTTACTGATG
TCGTTCACGACTACGACTCCAGCCTCGAGTCAAACGCGGCCGCGAGCGACCTCGCGGCGATCGAGAACGCGATCGACTACGCGCCCGACGAGACGTCGAA
TGCGCCGGAGACGGGCTCCGTCGCGAACGCTGTCGGCGCGAGCCGCCGCGAATAGCCGCTTGGGTGAACTCGGAGAGTGAGCGCTTATACTTCTCGATCC
AAGCGTGTTCGGTCGGCATGAGCGGATACTTGACAATATGCTGATCCCACTCAGCTTGCGTCGGGCGTCGCCCGATGTCACACGAGCTGCAACCTTCGCG
TACGTTGACATAGCACAAACGGTCTTAGGTCCAAGCGTCGTCGCAGACTTTCAGGCGCAGATCACCGAGTGAATGCTCGGCTTGTAGGGCTTCGCGATCA
CCGAGCCCGCCGACGACACTTTCTCCAGCCTCTTGCATCCGATTCCACCGCCGGATGAATGCGCACCATGATCTCTGCAAAGCTTCGTACGACGCGCCGT
CGAGTGTTTTGTTTCGGAGACGCCTGAAGCGCCGAAAGTGGTCCCGCATGGTGTCCAGCGCGTCCGGGGTCACCGCCCCGGACAAGTCGTACAGCGCCCA
CGGCTTCATATCCTCGTCCATTACGCCGGGCCGAACCCCAAGTCGACCCACACTCTCAGGTGCGATATCAGCGGTCCACCCACTGTTCAGCGTCGTCGCC
GACGCTGGAGCCGTCCGC