Description :
From Genome Similarity Track
Location :
scaffold_74:9578- 11974
Sequence
2396 bases(100 bases per row)
AACTACCCCTTACTCACCAAGCAGACCTGACAGTGAGAGGCCCTCTTGTGGCTTGCTCGTGATCTCACTCGGTGATGACGGTTTGCCAACTTTCTTCGGT
GTATGGTCGATATAGATACGGGTCAGATTCGAATGCTCTATATAAGCTGCGCCATAGTACGTAGTAAATTCAACAGCTCAGAGTTGCATCTCACACTTTA
GCAGAGCGTACCTCAGTTAAAGCGGATGGTCCAGATGTTGCTTTGTCTCATTGAAGCGCTTCACATCTGAATGGCTCGACAAAGCGCAGAGTTGGCGCGG
ATTTAACAAGTCAGCATCAAACAAAGGTTGGAGTGTATGATCGTCGTAATCCTTAATTTTTAAAATGGTCCAAGCTAGCTGGATTGCGCATAAATATTAA
AGTATCCGTGCATGGAGATACTCAATAATCAATAAACCTTGTCCAGTTCCATCTGCTCATGGAGTCTGCATGTTGCTTATGCAGATTGTGCTTTTCAGCC
AAAGGGTCTCCAGCTCTGCGCCTGACGCTCAGaatcaaattttaaatttgatacGAAGTTTAGCTGGGTCGATTTTAACGAGAAAAACTTCATAATGTCC
GCTCTCCCAGCAAGCCTAAATTGCGGTGTCGAAAGAACATGGGGGCTTGCAAATCCTCCATGTTAATATGAGACAGGTTCTCGAGACTTCGAGGCATGCA
CAGAGATACACAACGCATCATCAATGTATAAGAGCCCTTTGTTCTTGTCATCTGCATAAGCTTGTGCTAATGGGGATACCCTGTCTGGCCACCTGTCTGT
GTCTGGTCAGTGGTAGAAATGCCCAATCTGGTACACAACACCTTTATTGAAATTTTGTCATATCCACTGACGATTGCGGGTCTTGATATAGAAAATGGTC
TCCAACAAGCAATATTGGCGGAACCTTTATTAGGAAGCGGCTTGGCTATACCCTCACCGGTATCGGTGTTGCTGAACGCAAAACGGTGAAGTTTTGCTTA
GACGGTCCACTCGAGCCCATGTAGAAGCTTGTCGACTGATACATGCTGTATTAATCACATGGCGTTCACTGAGCAATTTTTCAGGGGTGGACACCATAGA
TATGTGCCTCGTACAGCATTTTGATTCTAggatcttcatcatcaataCATCTAGTTCCTTTTCGTACGCTAGTTCAATGCGTTGTCGCAGTCAAAATAAG
CAAaatcgcatccgccacagCATTAAGCCAATTTGGCAAGTACCTTACCTTGTCGACAAAGATTGATAACCGTTGTGCATTTTCGTTAAAGATGTAGTAA
CGACAGCGCATTGCGCAGCAATGTATGAGTTGTATCGACCGCTTAagaagccaagcaggtgcactacaaaattgatgaggacattttcattgcaagtagc
tccttgaaATGAACAGGATTGCCCTTTTCGACCACTTTAAGCTGGCGGGGCTCAAATGTGAGGATCAGTTTGCTCCCATCGGCATGTTCTCGGGGAACTG
CTTAGCCTATCGCAAAGGCTAAAGTTTTACAGACGACATGGAATGGCCGATCTGGATTTGGAAGAGCCAGATCGGGGCACCCATGAGGCGTTTTTTAAGT
CTTTAAGGCCACCTATTTGACGCCCTTATTAAGGAAATAAGTGATGAGATGTACTATTAAGGCATATTTTGAAAAGTCcttgtgcaagaagttggTCGGG
ATAAGCCACTTCCTCCTAGTCCACTTGCGACAGAAAAACTGGTCAATCAACATTGATCTTTAACCTTGTTAGATCTCTCCAGATAAACAGCTTGGCAAGG
TTTTCTTATCCACACCGAAGCCAAAGTTGTCTTAATTGACAGACATTTGATAAACGCAAATAGCAAAACTTATATTCATTGACAAACATTTGAGAAACGC
AAACATATGAGTACTGCGTGCAAATCTTCTATGCAACTCCACCCATCCGAATCCTCGTGCCCCGCAAGACTATGGTGATTTTTTCAATGGAAAATAGAAT
TGTGCAAAGGATCGATGCGGCCAAGAAAGACATATCCTCGGACAATGAACGTCGCCTGTGCATTAGAAAATCTTTGTGACATATCAGCCCCTCCTAGATA
ATTAAGCTTGGATGTACCCGGAACTTTTACaagcatttgaaaaaaatatcatttaGGCCACCTAGGTCAAGAACACTGAACATGGTGTTATTTCTATTTG
CAGCACAAAGACTCACGAAAGCACCATGAAACGAGTAGTGTGTTTGGCATCATTTGCACCCGCCTTCAGCCGGTTCGTGACGTTCTAGCCACACCATACC
GAGGATGAATTTGTATCTCAAAAATATGGAAAGAACGAGATATCGTGCCTCGCTGTCAAATGCCTGGATCCTCATAAAAAGATCAAACATAAAGAG