Description :
From Genome Similarity Track
Location :
Scaffold_2:95773- 128320
Transcript NameFunction/comments
Physo_108169protein kinase C inhibitor
Physo_108170predicted protein
Physo_127441PREDICTED: similar to kinesin-associated protein 3
Physo_127442hypothetical protein
Physo_108171predicted protein
Physo_127444hypothetical protein
Physo_108172predicted protein
Physo_108173predicted protein
Physo_127447serine/threonine protein phosphatase, putative
Physo_155292hypothetical protein
Physo_127449hypothetical protein
Physo_155294hypothetical protein
Physo_127451AGAP005391-PA
Physo_127452hypothetical protein
Physo_127453GTPase Ypt3
Physo_127454threonine synthase

Sequence
32547 bases(100 bases per row)
TTGACAGGCATGCTCATCGGCCGCAGCTTCCTCGTGGCGTCTAGACCCTCGCGCCGCTCGCTCGCTCCCGTCGCCCGCCGCGCCATGAGCTCCGACGAAC
GCGCCAAGGCCGACGCCGCAGCCGCCTCGGGCGCTGCTGCCGCCGTGGGTGAGACCATCTTCGACAAGATCATCAACAGGCAGATCCCCGCCAAGATCGC
GTACGAGGACGAGCAGTGCCTGGCCTTCCACGACGTGAACCCGCAAGCGCCCGTGCACATCCTCGTCATCCCCAAGAAGCGCGACGGCCTCACGCAGCTC
GCGCACGCTGAGGAGCGCCACGTAGCCGTTCTGGGCCACCTGCTCTACGCCGCCAAGCTGGTCGCCAAGCAGCAGAATCTGGACAAGGGCTTCCGCATCG
TCATCAACGACGGAGAGGACGGCTGCCAGTCCGTCTTCCACCTGCACCTGCACGTTCTCGGTGGACGCAAGCTGGACTGGCCTCCCGGGTAAGAGGAACG
CGTCCGTGGCCTCCTCGTGGTACTCGAATGGGAGAAGTGAGACGAGCATAGGCAAGATACTCTCGGGGCACAAGCCGCCCACAGTTGTGATTGTTTGTGG
TAGAGCATGCTAAGCAGAAAGAATCTATCATTTGTTGAAATGGCTTCTTCGCACGTGTGGCGTGCCAGGCGGTCTAACCCCGGCCGCTGATCTCCTTGTG
GAACTGCTCCAGGAACGTCTCCATGAACGCGTGGCGCTCGTCAGCCAGACGCTTCCCGGCGTTCGTCTTCATCATGTCACGGAGCTTCAGCAGTTTCTGT
GCCAACAGAAAGGAATTAAGCGTTTGCTTGAGTCACAGAGCAACAGTACGACGTACCTCGTAGAAGTGGTTAATGGTGGTGTTGGGGCGGTTGGGATCCA
TGTATTGCTCCTTCGTCATGCTTTCGATTGGGGGCACGTCCGGATCGTACAGCGGGCGCAGCTTGTGCCCTCCGTAGGTGAAGCAGCGGGCAATTCCAAT
GGCTCCGATCGCATCCTGCACATCCACGAGCCATGTCAGCCTCATTCACGTGAGACATCGCCTCCTCAGCACATGCTCAACAAGGTACATGTAGCCTACC
AGTCGATCAGCATCCTGAACGCAGCCGTACTCGACAGTGTACGATCGCTGCGGTAGCCATAACTATTGTGTTAGTCCGGACGAGTGATCATGCCAACTAG
GGGCAGTAGCGTACCGCGCCAGTGCCTGCGAGCTCCTCCTTGAACCCCATGCTGTCGATGATGGACATCACGCGCTCGATCTTGTCGCTGGGCACGCTCT
CCGACTGCAAGAAAGCCACCGCCCGCTTCGTGGGCTCCTCCTTGTCGCTCTGGTACTTCCAGTCGTCGATGTCATGCAGCAGCGCCGCCAGGTCCACGAT
CTCCAGGTTTTCCTCCGGCACTCGCTGTACTCGCACAACAAGACCAAGAGTCCATCACATCAGACAGAGAACCTGAGAGCTGCCGCCGCAGACCTCCACC
CACCCACCTCCTCCTTCGCGAGCGTCCGCGCCACCGTCCAGACTCTCTCGATGTGGCGCCAGTCGTGCGACGCGTCGTTGCTCTTGAGCTGCTGCTCCAC
GAACGCCGCCGTGCGCTGCACCAGGCGGGATGTAGCCATGTCGCTGGCTTTCGGTGGTCCTCGGCAAATTGCACTCTGAGCGACGAGGATACAATACCGT
CAAGCAGCGCCAAAACGCACAACGCCCGCGGATTGGCCGAAATGGGCGGCAGCTTCAACTTGAAACCCCTCAGTCGCCAAGAAGCGCCATGAGCACGAGC
AGCTCCCGCAGCGCGAGCTCCAGCCGCAGCCCGAGCCATGCGGCGGTCGTCAAGAGCGAGAGGCCCCGCAAGATCACCGCCAAGGCGGACGAGCTGGACG
CGTACATGGAGAAGCTCTACGACGACGACGTCGAGTCCAAGCTGGACGGGGCCAAGATGATCCTGCAGCTGGCCGAGTTCGCCGGGAACATCGAGGCGCT
CGTGCAGAACGAGTCGCTCATGGTCCGCGCTGCTGCTTGTCGAGTCTCTTGGGGGGTGAGTGGGGTGGGTGGGGGTTCTAGGGGCTGACGCTTTGCTCTT
TGCTCGTGTCTGCAGAGTCTGCTGTCGCGCGTGCTGAACGACGACTACAAGAAGAGCTACGACTTCTCGCTCACCATGATGCGCATCTTCTGGTGTTTCT
CCAACTTTCTGCAGCTGCACCCGATCCTGGGCAACTACCGCATCGGCGCCATCACGCTCAAGATCGTCGAGTTCGAGCTCAAACGCCACCAGCTGCGTCT
CGAAGAGGAAAGACTGCTGGAAGCGGCGGCCAACGAGGCTCCGTCGGCTGACGGCCAGTCGACGGAGGACATCCTGGCCAAGCTGGATCGCGAGAAGAAA
CGCAACAAGAAGCGCATGAGGAAGCAAGACCAGTTGCTGTGAGTCTTCTGGGTTGTTTACATGCGCTAGTTGTCTGCTCTTCGTTGTCGCAGCGCTCAGA
CCCTGATACATTCGTTTGCCTCTGTAGATACGTGTGCTTCAGCGTGCTTCTGAATTTGGCCGAGGATATTCACACCGAGCGCAAGATGGTCAAGAGGAAG
ATTGTGCAGTTTCTTACAAAGGTTTGTCCACTTGGCTAAGCACGAACAGTGTAGTTGATCTCATGTTGGTGTCTATTTGATCACGTATTGTGTGTGCATG
CGTAGCTGCTCGATCGTGTGGCACCCGACCTGGTTATTCTAACCATCACTTTTCTCAAGAAGCTGAGCATCTTTGAGGAGAACAAGGATGCGATGGTGGA
GCTAACAGTAGTGGAAAAGCTCGTACGCTACCTGAACTGCAACCACGACAAAACCATCCAGACAGCCCTCAAGCTGCTGTTTAATCTGTCCTTCGACCCA
GCTCTCCGCGAAGTTCTGGTGCGCAATAGTATCATTCCAAAACTGGTGGAACTGCTCAAGAAGCCGCCCTTCCGTGCGCTATCACTGCGAATCCTCTACC
ATCTCAGTATCGATGACCGGTGCAAGTCGATGTTCACGTACACGGAGGCGATCCCAATCGTCATGCAGCTGGTGATCAACTTCCCCCAGAATATTGTGGC
TAAAGAGCTTGCTGCTCTCGCTGTGAACCTCAGCCACAACGCGCGCAACGCTGAGCTCATGTGCCAGAATCGTGGCCTCGAGGCGCTTGCTACGCGAGTC
TTCCGTACGCGTGACCCACTCCTCATGAAAGTGATTCGGAACATCTCTCTCTGGTCATACACACTTCAAGAAGATTTAGTCAGTGACAAGGCGTACAAGT
ATCGCGGTATGTGGGCCCCCTTCGTGGTGCCATTCATCGAGCTGTGCCTTAACACGGACAACCACGACTTCTCGATCGAAGTTTTGGCAACGCTTGCCAA
CATGACGCCAAGCGATTTACCTTCGAAGACATCTTGGGACAGACTGGTGACGGATCATTCGCTCATCCCTTTCCTCAACAAGCTCCTGGTCCCGGGTTTC
TCTCAAGACGACATGATCCTAGAGGTCGTGCTATTCGTCAGCGCGCTCGCTTTGGAGCCAAAGTGCGCTCCTCTCCTGTCATCGTCTCGACTCGTGCGCA
CGTTCCACTCGCTCTTCCAGGAGAAGCAGCACGACAATGAGCTCACCCTGCAGCTGCTGTACGCGTTCTATCGCATGCTGCGCCACCCGGAGACGTTTGA
AGAAATCTTGTTTGGCGTGGGTTTCGTGCCAGACTTGCTGCTGGCAGCCGACGCTCCTAACATCGAAGTTCGCCGCATGTGCGACGTCCTGATGGACTTG
ATTTTGGACCACGACCTCAATGATGGTGGAACTATTGGCGACTTCGGCCACCTCATTCGGCAGCGAAGGTTTGAGATTCACAACGCCGAATATCTCGAGA
TGATACATGCAGAAACTCAGAGCGCAGCTTATCGCAAACACCACGGGATGGACGACGACGGCGGTAAGGGAGATGATGAGGATGATGATGATGATAACTG
ACCGGTAACCCAACAACTAAACGAAAAGGCTGCGCAACGTTCGGGTCCATATTAAATGTTTCAATTTCTCGTACTTCTGCTCCTTCAAATGCTCATGACC
CTCTACTCAACCAATCCTCTTCTTCGTCAAGAACCCGACCACGCTCTTACGATCAATACCAAAGCGAGGAAGCGCCTTCTCCGGCCAGTAGGAGTTGTGC
TCGCTGTTAATTGATGCTCCCGGTGGGATCAAGTACATGTTGTACGGACACTCCGGTGAGATGGTCAGTGCGAGCGCGCGCGAGTTGTGCTTCCGCTTGT
CCGAATAGCGAACTAATTGCCGTACAAACTTCCAGTGGTCGTAGGCCGACTCCAGGCAGAAAAACGCCATGGCGGATTCGTGGAGATTGCGCACCTCGGT
TTCCATTCTCTCCATCCCCACCGTTCCTCGCTGCGTCACGACAATTCCTCGACCATCAGGAAATTCTGCAGGTGCCATCCCATCGCGAGTGCGGCACCAG
AACGCATCCACAGGAAACTCATGAAAACTGCTAGTGTCGGACGCGTCTTGGATCCGAATCAGACATGACCAAGCAACGGTAACGGGGAGCTCACCGTCAA
TCTCCATCTTCTCGTCGTCGCCGTCGAGTGGTTTTGAATCAAGTCCGCAGTCGATCAAGTCCACGAAAAACTGCGCGGCTCGCCATTCAACCAGGCGCCG
AGCCTCCACTTCCGTATCCCAAGTAGCTCGGCACAGCATATGTCCGTCTACGCGGATAGCGCAATGTACACCAGAGCGTGAATCTTGAGCACTTCGACCA
AACGAAGGACGGGGTGGATCTTCCACAGTAGTTGTAATCTGAAGTTGAAAAGGAAAATCAGCATGCACTTGTAGTTAGTTAGACAACAGCTACAATCAAC
CGGCACAAAGAAAGCAACGTACACTAGCGATGCCCGATAACTTTAGCGCTTGGAAGGAATCCACATGCGAAACGTTTGCCAGAGATTTGTTGTCCAAAAA
ATGCAACAGCTGGGCCCAGATCGATCGGATCCTATTCAGCTTGCCTAGCATACCATCAACCGCTGCATTGCACGCATCAGGCTTTGCCGTTTTCGACGCC
TTGAAGCGAATGACATCATTGACATCAACGAGAACTTCGAAGATGCCTTCGCGCAAGCGCTCCATCCTAATGTTTGCCGCGACATTAGGCACGATCCTTG
TGTGCTCAGCCCCGCGATACTTCAGCGATCCTCTTAATCGATTTATACCAGCACACAATTCGTCCGTCGGGGTGAACAAGCTTCTGATCGCAGCGCGAAA
CTTTGCATCATCTGAAGTACCGCTTTCGGACTCTTCTGCATACCGTTTTCCCATTTCTCTGGTAAATGCCGCTTCTCGTTCCGATACAGCGGGGGGTTGA
GATGCTGTTTTTACTGCTGACGGATCCCAGTCGTCGTCGTCATCAAATCCTCCATCTGAATAGTCATCATCGTCGTCATCCATTTCATCGTCACTGCACA
AAATAAGGTTGCTCTTCTTTGCTTGGGTCGGTGGAGGGGGACGTGATTGCCTCGTCGTAGTAGATCCTGTTGTCCCTGCGTTACCTGTCGACCTGGTAGT
GCTCGTTTTGGAGCAAGATGATGCAGGGGGTGGCTTCAGCCTGTTGAGTTCCTCCAGAATATCGCGCCATCTCTCGTTAGCGGACCGCTTGGCATCTTTC
GCGTTCAGGCAAGCTGTCGAAATTGTAAGCGTATCACGGACCCAGATGAAGTACATGTACAGTGGCGGAACAAGCTTTTCAGACGCCGACACCTGTAGAC
CATAAGTACAAATCCCAGCGCGTCAACAATGGTCTTCTAACAGCCAGTATGTACAGGCTTACCTTGTCATGGTTTTTGGCTTGAGTTTCATTACCCGCCA
TCAACGTTGTCGGTGTTTGAGTAAGTCGGTCATTATAAGTAACAAGTAGCGCCATCCAAGTACCGATGATGCCATCCAGCGTATTGATCAGAACCGTAGT
AGCCTTGTCCTTAGCAATCTCAATGGATGACGCTTCTCCACAGGCCTCGACAACGCTCTCAGATACAGTGAGCACGCAACTGACTACACCATTATTTCTT
CTCGTTGCTGTCCGGGTTATCTAATACATGAAACACAGTAGGCATATCAGGTTATCAACGTTCAGAACCCCAATGAGACCTGCAGTTAGAGCGATTACCG
AAAATGTCGACGAAAGCGGAAGCGTTTCCGACTTGACTCGCAGGTCCCACACAATTCCTTTCACAGATCTTACGACTTCCTCACGGTCACGGAAGAGAAG
CTTCAGCAGCTCTTGATACATCTCCGACTTTGCCTTCGCGGTCTCATCTTCTGAACGGGGAGGGGCATCTTGTCTGGGGTCTGAGCCGCTTCGATCTTCG
ACAAACAGGTTCGCAGTACTCGCAGCAGACAGGGTGTTGCCTTCCCGTTCGGCATATCTTCTTTCTGATTGCGGAAGTGTTTCTGGTTCTCCGGTTGAAT
ATGCCAGGCGAGGACGAGAAGTAGCGCGCTCATCCTCATAACTTTCATCCGTGTTTGGCGCATAGTGTCGCTTCCGCAGAATGCCCATAGACCTCAACTC
TGCGTTCCTTGAATCAGCATTTCCGACGCTTCCAGTGCCAGGGCGTTCATGTGCACTCTTCATCCCACCGTGATGACCCGCTTCATTGTAGTTGTCCGCC
TCGGTGTGGGGATCAGCGCGATCTTGGTGAGGCTGAACAACTTCTATCTTCGTCGGTTCAAACTCGTTCTTGATTTGTTCAACGCGATCAAGTTTCAGGC
TCTCTTCGTACTGATCAATCAGCTTCATCAAGAACGACAGGAGCTCATCGACTGCTTCGCTTTTTGTACTAGGCACCGATGCACCACGCTTGCAAACGAG
TGGAAACTCTTGGATGTTAGCCACTACATCATACATAATGTTGTCCGGATTGCCACCAGGCCTCTCATATAGCTGCAAAGAACAAGAAAACGTTAGAGCC
GCGGAGTAACTGAGATCACTGCAGTTAGTAAAAGCACACCTACCCGCACAATCTTTTTCGTAATCAGGTAGTTGAAGGTGGCGTCCTTCACTTTCCGGGT
GTCATTGGCCGGACAAAAGCCGAATTGACTTTTCAAATGCGCCAGCAAATCACCGTATAGTCTACGGTGCTCCATCACAGCTCGTGTCAGTCGCGATAGT
GCACCGATAGTCGCATCTCGATCCACTGTAGCCGTGGAATCGAATGACAAATGCCCTAATCGGACGCGAGCGTTATACTGGGATGGCCCAACCATGCGCA
CTTCGCGCCGAAGCTAATGCAAAGCCACGGTTAGACACAGCAACGATCTCGCCATAATACAGCAAAACCCTCACCTTGAGTCCAGCTGCCACATTAAATT
CCTTACTCATGGTCGACAACGATACAGATTGGACAGCAGTTGCTAATTCCTGGAGTGTTGACACGATATCGACGTTCGGCCCGATCAAAGCTAGCAGGTA
CGCTCGGCCTTCATCCACGCCATAGCTTCTGGGCTTGGGAGGAGCAACAGGTTCCTTCTGCTGTGCTGGTGGAGGCTGCGGGGGAGGAGGAGTTGAAGTT
GGTGCCGTAGCTTTAGCAGTAGTGGTCTGCACAGGCGGTACATCCAATGCAAACGTCACTCGTTTGTTCGGCGTGGTCCTCGCCGCTCTAGACGCTGAAC
CATTCTGACGCAGGATCGACGGTGTGGTCGACTTTGGAGCAGGGTTGCTATTGTAGCTGTCGTTCTCGGGTTGCTCCGGGCTCATGTCGATGGCCATGTC
CTCCACAGGTTGCTCCAGCTCCTTCTCACCGGCCATCACCACATCCTTATCTGCTGTGGCAACTGCCTCCACCTCGCTTTCTCTCTTAATCTTCGCATAC
CACTCTCGAAACTTCGCGGCAAACTGGAACTTCCTGTCCTCCATGACAGACTTTCTCGTCTCGTGGCTCATGATCTTCACGTACATGAGCAGCTTCTTGG
CCGAGTGCAGACGCTGCACGGCCAGTCGATCCTGCGCGATCATCTGCTCGTAGCGTGTGGACAGCTGCAAGCGGTGGGCGTCCAGCTCGTCTAGAATGCG
CAAGACGCGCCCGGGCGTGCGGCCGACTCTCGGGTCGTCCCGCACGGCCGCCCCCATGCGCACGAAGCGCAGCACGAGCGTCTTCCTGGAGCCTTTGCTC
TGCTCCTGCTTGATGCTGACCTCCGCCCCCACAGCCGCCACGTCCTTCTCCACCTGCTTCAGCTTGCGCGGGCAGACGAGAAAGTCCTCGACGCCCATTC
CCACCAGGTAGTCGTCCGCCTCGACGGTGCAGATGGGGTCCGTGGCCGAGGACTTGCCCGCCACTTTGTCCACGAACTCCATGGGGAAGCGCGGCGGCTC
GTCCGTCCGCTTGTCCACCTGGAACACGTGCGAGTTCATGATGGCGGTCACGTGCACGCCCAAGTCCGCGAGCTTCAGCCCGTCCAAGGCCGCGCTGGGC
AGCGAGTAGCGCACGTCGTAGGCGCGGCCCAGCGACAGCAGCTTCCGCGCGGCCAGAGCGACCTCCACGCGCCACAGCCGCACGGCCATGTCGAACGCCA
GCGCCTTCGAGTCGGCCGACAGGTCGACGGACGGCTCCGCCAACAACGGACGCATGAGCTTTGCTGCCTTTCACTTTGGCTGCTTCGACACTGAACGAGC
CGGCGACCTGCGAAACCTGTGAGATCTGATTACCGAGTATTGAAAGGTGGAGGTAGCTCGTCAAAAGGCAACTTCAAGCCCGATTCTTGTCGCCGTCTTT
CGGTGGATACGCAGCATTTGATGAACCAAATTGGACGCTACTGCAGCAGCAGCAGCATCGTCCATATTATTTTTTACCGAGTGAAGGGGGAGGGTGGTGC
ACATTGCAACGTTTCCTTTCTCACTCGCTTTCACGCTTCGACGTACTGTAGAGCCTTACTCCATCAGGAAGATGCGGCTGGCGACGTCCGCAACAAGCCA
GTCGATGCCGTCAACGAGACCGTCACCCGTGACAGCACTGCAGGAGATAATGCTCCAGTGCCGAGTAGAAAATTGAGCAGCGCGCAGTCCTAGCGCGTCC
GCGATCTCTGCAGAGGAAAGAGCGCCAGCTAAGTCCTGCTTGTTAGCGAAGATGAGCAGTGTAGCACCCGCCAGTTTCTGGTAGTGTAGAACCAACCCCA
TGTGTTAGCAGCAGATAATCATACACACAACAGTAGCAAATGCAATACACACAGACCTCTTGCGTCAGCAGACTGGCGAGCTCCCGCTTGCAGTCCTCAA
GCCGCCGTCGATCGGCGCTGTCCACCACCCATACGAGGCCATCCGTCTGCCGCACCACGCCGCGTCAGCTGCAAACTCCACACACTCCAGTACCAAGCAG
TGCACTGCAGACCTGTTCAAAGTAGTTCCTCCAGTACGAGCGAATGGTCTGCTGGCCCCCGACGTCCCAGACGTTCAATTTGAAGCTGGCGGCAAGACAC
AGCACGACAACGGTCAGCAGTGTCCATATGCACCTGCAGTCGCAGGAAGACCTGCTCACTCCTTGTACTCGAGCGTCTGGATGTCGAAGCCCAGCGTCGG
TGAGATCTCCGTGATGTCCTGGCCCATAAACTTCTTGAGGATCGTCGTTTTGCCGGCATTGTCCAGGCCTCTGTCCACACAACAACAACAACAACAACAA
CAACAACAGCAACAACGCGTCATCCCTCCCTGCTCCTTTGATCGCTACGGCTACCAAACGCACAGCATGAGGACGCGGATCTCCTTCTCCTTCTCCTTGA
CCTTCTTGAGGATACTCAGCAGCCCCATCGTCGCCACAGCAAAATAGTCGGAGGATCGCCTGTCAATCTCCTCGAAATTGCAAAAATAACCATGCGAATG
CGCATGAAACGACGCGAGTTCAACCTGTTTGTGAGCGGGGCACAAGTGACGAAGCTCTGCTAGGCTTACCATGACCAAGGCCGTTCCGCCGAGACGATGG
CTACTGGAGAAGCGCGACGGCAACCAGGAGGACGCGCACGCACCAGGACCCGGCGCTCGACCGTCCAAAGCCCGCTTGCCCCTGCAGCAGCAGCACTCGC
CGGACTGGGACGAGGACGCGGAGCCTACAGACACTCGAGACGCACGAAGACCGACGTCGCTTGAAGAGCTGCTGGACCTCGAGCTAGATCTGGTTCTGCC
CGTGACGGCAGTCTCCGCTCCAATGAGCAACCAGGCGCCTGCGTGCGCAGCGAAGGAGGACGAGACCGTCACTGACACCGTCTCGTTGGAGCTGCTGGTG
AGAACGGGTCATTTGTGCATCGAACGCTCCAGAATAGCTCACGTGTGTTTGCTCCCGTGTGTTGCAACAATGTGCAGGCCATACAGAGCCCCCACGGCGA
GAACCAGCAGTGGCAAAGCGAGGAGGACGAGCAAAATGCCGTTCGAAGCAGACCAGAACACTCCCCACGACACCGGGCGAAGGAGATGTCAGCTCCCAGG
AAGCCCTTGCCACTGAGTCTCGTATCGCCGACAGCCTTTATTCCATCGTTTTCTCCTTCATCCCGGCAGTCCTCGGCCGACGATGACTACGGCTTGGCGT
CGCCCATGGCACTACCCGACACGCCTTCTTCACAAGCTCGGTCAGGGATTGCATTGGCCTGGGATCTCGATCCACCGTCTCCAACATTGGACGATGCACA
TGCCAGAGCGACTCGTCTCTTTGCACAATCCAAGAGCGTCCAACGGCCAGAACGTCGAGCCTCGGCATCTGCAGTCGCAGCTAGAGCTGCCACGCCGAAC
CCGCGCAACCACAGGAATTACGTGCCAGATAGAGCTGCATCTCGGATAACGAGGTCCTCACTCCCTACGTTGCCAGAAGTCCGAGCCAAGGCCAGGCACG
GCGGGATCTATTCGTTGCTACTGAAGAATAAATCTGCAAAGCAGGAACCAGTGCTCGTAGAAGACGCGCAGAACCCTGAAGGTACGAGCTGTACCCCGTC
GCTTGAAAGGCTCGATGTCTTGATAACACCCTGCGTTCACGTTGTTGTGCACCCTTTAGTGGTGACTGCGGCGCTGTCCGTATCCAAGGTGAGTGTGCGC
ATGGCATACACGGTTGATAGTTTCAGGGCGGCTCTCACATCAGTACTCTCGTGTAGGTCTCCCCACCTCGCACGTCCGGCAAGGCAAAGCACGGAGGCAT
CTACAAAATGCTTCGAGCCAGCCACGGACCGCATTAGTCTCGTCAGCATAAGCCGCATTTGGGCACAGTTGGAGAGCATTTTGCTATACAGTAGCTTGGT
TGCGCTCGATCGATCAAACTGCATTTTTGTTTGAGTTGCTTTTGAAGTGGATTTTTCGGAAGCATTGTGGATACATGTTTGATGAAATGATTGCGCCATT
TCGTAATCCTCACACTCAAAGCACGCACAAGATGAACCGCATTTTCGGCAAGAAGAAGCCCGAGGCGCCGCCCGTCAACATCTCCGATGTCGGGGGCAAG
GTGGACGCGCGGGTCACGGACCTGGACATGAAGGTGCGTTGTCAGACGCTGCAGCTTCTCCAGCCGTGATGGTGTCGCTGACTGGCTGCTGCTCTCGCAG
ATTGAGAAGCTGGACCAGGAGCTGCGCAAGTACCGAGAGCAGATGAAGAAGACGCGAGGCCCAGCCGTTAACTCCATCAAGCAGCGAGCCATGCAGACGC
TCAAGCGCAAGAAAATGTTCGAGGCGCAGCGAGACAAGTTGCAGGCGCAGTCATTTAATATCGAGCAGGTGAGGGCCACGATAGCTTGAGAGTTAGGGAA
CGCCTGGGGTTACTCATCTGCTTGTTGGCTACTACGGGGCCCAGGCGGCGTTTGCGATCGACACATCAAGAGACACAATTACCACGGTAGCCGCCATGAA
GAGCGCAGCGGTGCAGCTAAAGGCGGAGACGCAGAAGATCGACATTTCAGAGCTGGAGGTGGGTCTAGGAAAAAAGCAAACTCATCGAGGATGCTGTCTG
GGTAACGGGGCATTATTGACATTTCCTATATATGCGTGGTGCAGGACGTGCAAGATGACATGGCAGACTTAATGGAGGACATGAACGAGATTCAAGAGAT
CATGGGCCGCTCCTACGGGTACGTACTCATAGAAATCGCAGGCATACGACGCGAATTTTGCTACAATCATAAACGTTCTAGCAGCACATCTGACCACGGT
TTGTCTCCTTACAAACACCACAGTATCGGCGACGAGATCGATGAAGACGAGTTGGAGGCGGAGCTGGAGGGGCTCGAGGAGGAGTGGGCTGAGGAAGAGG
CCCTCGGAGAAGAAGCAGAGCAGGCGCCATCCTACCTCGCGCCTGCTCAGCACCACGAGCTGCCCGCTGCGCCTTCAGGCTCCTTAGACTCGGGCCGGAC
TGCTCGCGCCACGGACGAGTTCGGGCTGCCTGTGGCATCGTACTCAACGTAGAGTTCGCGATGGCTGCACTCAAGTTGACGATCGATCCATCCGTCTGAG
CAAAGATATCCAACCGAGAATATCATGCTGCGTGTTTGCTACAACCCGAGCACTTGTCAAATGGGAGAGATGGCTACACACCACGTCCGTCGCGTCGATA
CGAGCCGAGAGAGCCAATCATTTTCAGGAATCAAGTTGGACAGGGACATAGCAGGTTAGGCAGGACATCCAGTCTTAGAACCGTTTCTGTAAATGGTTTA
TCAGAGAATGTGCGACACATAAGAATCGAGTTTTACAGTGCAGCAAGGTTTTACCCTCACCGAGGTTTTATCACCTCCGTCGCCACGCATTTGGCTTGGC
TCACTTTGGTATTGGTGGTTTTGGTGAACAGCTCTTCGCAGATCCCAAGCAGCAGCACAGCAGGCAGCAGCCATGGCCCGCGAGAAGAAGGAGCCGCGTG
TGAAGAAGGAGCGCAAGGGCAAGAAGGAGTCCCGCAAGAAGGCCGCCGAGGAGAAGAAGGCCGCCGAGAAGGCCGAGGCGCTGGAGAACATGTCGCTCGC
CGACCGTCTCGCCGAGGAGGGCATCATCGCCACCTGCTCGCACAACGTGCGCTCGGTGCACAAGAACTTCAAGGACATCAACGTGCTTAACTTCAGCATC
ACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTACGGCCGTCGCTACGGCCTTATCGGCCGTAACGGCTCGGGTAAGTCCACGT
TCATGAACGTGCTCGGCGCGCGCGGCATCCCCATCCCGGAGAGCATCGACATCTACCACCTCAAGCACGAGATCGAGGCCAGCGACATGACGGCTCTCGA
GGCCGTGCTGTCCGTCGACGAGGAGCGCAACAAGCTGCAGGCCGAGGCCGACGAGCTGTCGGAGCAGATGACCGACGAGTCTCTGAGCGAGGAGGACAGC
GAGGCCATCTCGGACCGTCTCACCGACCTCTACGAGCGTCTGGATGACATGGACGCCGCCACGGCCGAGGTCCGCGCCCGTCAGATTCTCTCGGGTCTGA
CGTTCTCGGACGCCATGATGGACAAGAAGACCAAGGAGTTCTCTGGTGGTTGGCGTATGCGTATCGCCCTGGCCCGTGCTCTGTTCATCCAGCCCACTCT
GCTGCTGCTCGATGAGCCCACCAACCACTTGGACATGGAGGCCGTCGTGTGGCTTGAGGACTACCTGTCTCGCTGGAAGAAGATCCTGCTCATGATTTCG
CACTCGCAGGAGTTCATGAACGAGGTCTGCACGAACATTATCGACCTCACCAACAAGAAGCTCGAGTACTACGCCGGCAACTACGACACGTACGTGCGTA
CTAAGGCTGAAAAGGAGGAGAACCAAATGAAGCGTTACAACTGGGAGCAGGATCAGATCAAGCACATGAAAGAGTACATCGCCCGCTTCGGTCACGGTTC
CGCTAAGCTGGCCCGCCAGGCCCAGAGTAAGGAGAAGACGCTGGCGAAGATGGTTCGCGACGGTCTGACGGAGAAGGTCGAAAAGGAAGCCACTGGTGAC
TTCAAGTTCCCCAACCCGGAGCCGCTGCCGCCTCCGGTGCTTATGTTCCAGAACGTTTCGTTCGGCTACCCGAACTGCCCCGTGCTGTACTCTGGCGTCG
AGATGGGTCTGGATCTGGACTCGCGTGTCGCCCTTGTCGGTGCCAACGGTACGGGTAAGACGACGCTGCTGAAGCTGATTACAGGAGACTTGGTTCCGGT
TGCGGGTAACGTTCGGCCACACAGCAAGCTGCGTATTGCTCGCTTCAGCCAGCACTTCGTTGATGTGCTGGACCTGGAAAAGTCGCCACTTGAGTACTTC
CGCTCTCTGTTCCAGACCAAGTCCGTCGAGGAGGTCCGCAGCTACCTGGGCCGCTACGGTATTACTGGCGAGGTGCAGACACAGATTATGGGCCAGCTGT
CCGACGGACAGAAGAGTCGTGTGGTGTTCGCCTACATGGCCCAGCAAAACGCGCACATGCTGCTGCTGGATGAGCCTACGAACCACTTGGACATGGAGTC
TATTGACGCTCTGGCTCGCGCCATTAACAACTTCAAGGGTGGCATGCTGCTGGTTAGTCACGACATGCGATTGATCTCGCAGGTCGCCAAGGAGATTTGG
CTCGTGGAGAACCAGTCCATCAAGGTGTACCAGGGCGAAATCTCGGACTTCAAGATGCGTGTGCGTAAGCAGCTCAAGCTGGCCGACAAGGAGCCTGTCG
TGCCTGTCGACGAGTAGATGCTCTCGACAGGTTATCGCTCATTAGATGCTTGCTGTAGCCGAACTGCAGCGGCAAACGCCGTGGCGCACTGTTCTGTTTC
ATATTTGATTCCTTGCCGACCAATAACATAGATTGAGAAATCACACGTAGGCACTCTTGATGAAATGCATCTTCACCCCTTTGCATTACCTCGTTAGGCT
TGTACGCGAGCTAAATAGTCCAACGTTAGTCATCGTCCGCTTGGTTGTTGTCCTCGCCACTGCTCGGGTGAAGGTCATGGGTAGCGAGTCCGTCGTGATC
AAGGTTGCTTATTCTCAACGCACTGACCAGCGAACTGTTACTGCTGGATTCCTCGCCTTCGTCGTCCGTGTCTTCGCCATCGCCTACTTGACTGTCGCGC
GGTCGACACTGTGCCCCCGGACTGCCAGTGAAGTTGCTAGGTGAAAGTCCACTTGATAGGCGGCTGATCCAGGACGAGCCACTGGTCCGTCTAAATTGCT
GCTGTCGGTGGCTCCTTCCTGCATTTCTTGCTCGATTGAAGAAGCGCAAGTGCTGGTTGTCCACGAGGACGCAGCCACAACTCGCATCATCGCCCATACC
GTGGTCCTTGGACGTCGAGAACACTGTGATCACTCGAGCCGAGTTGCTAAAGGATAAACCCTCTCGGTTGGCTTCGTGAGCTCGTACAATGCGCGAGAAG
CCATACTTTCCGAGAAACGCGTCAATAACTCGAGCTCCGAAGCGCACCGCAACACCTCCGCGTGGACTTCTCCCGAATCCTCGCGAGTCCAGCCCCCAGT
TGCTAACCAAGTCATTTCGGCCCAACACTCCTTCATTTCGCACAGGGTCACCCCAAACCATGTCTGCGATCATGGAGAGCTGCGGTTTGTCAGCGTAGTA
CGCGGTGTCCAAGGTGTCCAGTGGCGCTGCCTTGGGCAATGTGGCGATACTCTCGAGCAGGTCTTCGCTGCCTTCGATAGGACGAGGAATTCCACCGTGC
ACGCAGAAAACGTCGTTGTCGATGACCGCGGCAACGGGCAGGCGGTCGAATGCGTTATTTAGCTGATGCCAGACAACGCCGCCTTCACCAGCTCCGAACC
GAGCCTTGCACTGCGCAAGCAAGCACCCTGAACCGTAGTGCGCCTCCAGACCATTCACAGCGCGCGTTTCGTGGTTGCCTCGCAGCAAGAAGATTTTCCC
TGGGTGGAGAAGCTTGTGCGCGAAGAGGTAGGCTGTGCACTCTAAAGACGCGCTTCCGCGGTCAACATAGTCGCCGAGGAACAGAAAGCTGCCGGCGGTG
AGCTCCAGCCCAAGGTGCCAAATGTGCTCCGCGAAGAACCGCAAGTCGGCCCAATTGCCATGAACGTCGCCGAAAACGTACACGGGGCTAGGCAGATCCA
GGCAACGTGCTTCACGCTCCAGCACGCCACCCACTTGAGCACTCATTTCTACAAGGTCCGCTGCGAACTGAAGTGAGCGCAGATATGGCTGAGTCGTCAT
CATGGGATCCGCCAGCGCTGCAAGAACGCGTCGGGCAACATTAACACCTGCTGTGGCCGTCACTGGCAACGGCCGTAAGGATGTCAGCACTTGCGCCGAC
TTGATGCTTCCCAAGCGGTCGATTCGGCCTGTCGGTTTGACGCCCGTGTCCGTGATGGAATACACTGTGGGGACGAGAGTGTGTGCCGACGATGGAGTTG
AAGTTGATGTCGACACTTGATAAGACGAGGAAGACCCATATGTGATGTCGCTCGTCGTGGGACTCGAGCGTCCCGATGATCGTGCTGAGGCAAGCTGCTG
CTTAAGAAACGCGATTTCCTTGTCGGTCTCGAGCTTTAACGCGACGTACGAATCGCGAAGTTTCTGCAAGTGCCGATCAAGTTAGTCAAGGATTTTTTCT
CTCCAAGTTCTTGTAGTCGAATCGATTACCTGGAGCTCTCGAGCGTTGTGCTCGTCACGCAGAAAACAGGCTTGGGTGCAGCACTTGACCGAGGCAGAAC
TTGACGCATTTGCAGGCGGGTTGCTCAGCAGCGAGCGCTCCTGACTGTGCTGATGAAGCTGGTCTCGTAGGCTGCAGCTCATTTCGATCGCTTCTTCTTC
TAGTCGAGCCCTGGTGGCGCGGTCTTGGTGTCCACGACGTCTGACGATGCGCAATGGCGCCATGGAGCGTGCTGCATTTTTTCCGCAACACCGTCATTCA
TGAACCGGAAATAGAGCACATGGGACGTAACTCCACCCAAGATAAGCCTTGGAAAATCTTTGCGAAGAGTCATATTCACCGTCAATTTCGGTTGATACCG
TTGCAGATGCCGAGGCCTCTCCTGCTGCTGGTGCTGTGCCTTCTTGCCGCTGCCGTCCCATGTCTTGAGTGCGGCCGAGCGAAGACGATTGACTACGAGG
CTCTGGAGAAGGCGTGGGAGGCTGGCGATGCTGAAGAGGAGCTGCTATCGGAGGGCGACGAGCACTACAGACAGCTGCAGAACAAGTAAGTGAGTCACAT
ACTCCAGCGTAAAATGAAGCGTAAAGTTCTAATTGCACAGCATTCGCACCCCCTTACCAGAAACGAGCAGGAAGCGAAGGCACTTGGGCCCCAAATGATA
TTCGTGACGATGAAGGACGGCACTCGAGAGCCCCTCCCGGACGTTGCATCACGATGGAAAGAGGTAGGAGGCGGTCACGATTGCACCGACACATAATATA
GGTTGCTGACTCAGCGTTGCTACCAGATGCTGTGGAATGGAGGGGTCGAAGTGAGCATCTACGAAGTCGCGGACTCCAAGTTGCTCGTCGGGCTGCAGAA
GGGGATTTTTGTCGAGGATGTCATGCGCTTCCTCAATGATCAGCACGACGTACGAGAGTACGAGTGGAATGGCAAAGCCTACTCAGCTGAACATAAGAAT
AAAAGACAAGGACATCGCAAGCGCCACAACAAGGGAACGAACAAGCGTCAGCGTAAGAAAACCGCGGAGGGGCCCGGCAAACACTCCGGCAAGCATGGGA
GGCGAAAACATCCGCACCTACAAACTTACGTCACGGATACAACGAAACCCAAAGAGATGAGAACACCAAGCGATGAATTATGAGAATCCTCCCTCTGCCA
CTCAGATCATGCAAAACCATTTTAACGTGGGCGTTATGTTGTCTCTGGAGTCATCGCACAGCGCCATCCAAGGCACTCCGCCCTCGCCGATTCAGTTACT
CGTGCGCTCACTGCGAATGGTTTCCAGCAGCGGGCCCAGCATTTTGTTCTTCTTTGCGTTTTCCACGACAGAGTTCAGTCTCGGGTGGGAGTCCGCGTCG
CGCACAGCGCTGATGGCGTCGAGTGCACGCAACGCGCTGCGAATGAGATCCTTCACGCGCTCCACTTCAGGGCCAACTTGGTCCTCCTTCACCTTCTTGT
TGATCGTCTTCTCCAGCGGGTCTATCAACGAATCCAACGCACCCACGATACTGCCAGGCTGAACGTAGCAAATCTTAATCAAGATCTGGTGGCTGAGCAT
TTGGATGTCGTCCTGGTCTCCCAAGCCTCGCTTGAGCTGGTCGAAGAACAAGGTGATGTCCAATTGCTGAGGCAGCACCTGAATCAGGGTGTCCACGCAC
GAGTACGCAGCCTTACGAAGAGGGAGGCCATCGTCCACCTTGTGCTTGAACGGACCTAGGTCCACCACGCGCTCCAACTTAATCTCGGTCGCTTTCAGGA
GTACGGGGAAGATACGCTCACGAACATACGGCACCAAATAGTGGGCGTGGTGGTGAGCCGCCGTATTGAGGACCAGCAGGGCAGCCCGACGAACGTGCAG
GTCTTCGTCTTCCAGAGCAGTCAAGAAGGGGTCGATGTGGGCGAAAATTGCGTTGACAGCTGGCTCCTGGGCCGTCGTCGTCATGGCGTACTTGAGGCTT
GTGACAGCGGTCCAGCGCGACCACACGTCTACAGACCCACACAGTTCCGTCACAATGGGCATGATTTTGGCACTGTCCGTCACAGCAAGTTTTCCCATGC
ATTCGCCAACCATGTTGCGGACACCTTCCTCCTGGCGTGAGCTCATCTTCTGCAGAACTGGAAGCACACGGTCCACGTACATCGCAAAGCCGTGGTGGGG
CTTCGCTGCGTGGTCCGAAATAACTTCGCGCAACGATGTCAGTAGAAGATAAGAGTTTTCTCCTTGCTCCAACTTTACCATGATGGTATCCAGGTACTCT
TCCATGTTCCCAACGCAAATGCTGCCGAGAGAATACGCGGCAGCGGCCTTCACTTCTTCGCCCGCATTGCTAAAGCAGTTCAGAATGATTTCCTTCACGT
CAGGATACCCAGCAAGCTTAATCTTGCGGCCAAACTCACCCAAACTGTAAAGCGCCAGTACCCGGTTCTTTTCGGACTCCGTTTGGGTGATATCGCCAAC
AAACTTCGCGAACGCAACCTTGCGATTGCCTTCGGTCGTCGCCACACACGTACCAGCGACGCACCGAGCAATGTTCATCACCGAGTGCTTCGATTCCTCA
GAAGGCGTCGTCATCAGCGCCTTGAACAGGTCAGTGAAGCGACTGCCCGGAGAGTTCAGCTGCGTCAGCTGCGCGAAGAGGCCCTTCAGGGCGTCCAGCG
TGGGACCCTGAAGCATGGAGCTATGGCATAATTCAAGAGTCTTCACTTGAGCGTTTTGCAGGAGGGCATCCGTCGCGGCAACATGAGGGCACACACGAAG
CGAGTTCGACACCAGCGTGATGCTCATGCGGCATAGCTGAAGATCCGCGTCTACAAGAAGCAGTGAGGCTTCCAGCATCACTTCACAGTGCAGAGTCTCG
GGCATGTTAGCGCCCTTGTGAACAACCAAGTCATTTAGGGTTGCCAGGGTTGCCTGCTTCAACGTGCGAGACTGCTGCCGCAGTAGCTGGGCTAGAGTCT
GGGTGCACTCCACGAGAATCGGCGACATGTCCAGGTTAAGCTTCGAGCGGGCAATGACTCCGATGGCTTTAATACTCTGGACGCGAGTAATTTCGTTGTT
CAGACGCTCCATGAGCAGTGGGTAAACTTCTCCCACACGAGGTCCAAGCTCGTCACCTAGTCGCAATAACAACACGTTAGCCCAACAAACAAAGTGTAGT
AGTCGAGTATGGCTGTCACGCACCAAGCACAGCAGCGATTTCCCCAATGCTGCTAATAGCTGCCTCCTTGATCTCTTGATCAATATCATGAACCTTCAAA
CTAGGTAGCACGGCTTCGAAAAACGGCACTGCATACGGCTTGTACGTCAAGTCCCCATCGTCAGAGCGGATAATACGGACAAGAGATTCGATCAAGCCCA
ATGCCTTAGCAACTGTCTTGTACCAGTCTCCCTTCGCGCACTGCACGGCAACCTTCACAATTGACTCAACGTGAGGTCGAAACGGCTCCACTGTGTGTGT
ATCAATGAGCAATCGAAGGAACAACAGTGCGTCCAGCTTCAGGTCCGAGTGCTTGTCCTCCACAGCATTGAGAACATTCGGCATCAAACGTCCGATATAG
TCCCCAAGCTTTCCATGCTCCACCATTGCGAGCTCGCTTAGCATCGCGACCACAGCACAGCGCGACGGGACTGAGACCTTCGTTCCGAACTGCTTGTTGG
CCCCCACTACGATCGCGTTTAGGCGCTGCTCCAGCGGAACAATGCACCAGTTCGACGTGGGTGGATGGAAGGAACCGGTTCCGTTTGAGCTCGGAAGGGT
CTTGCGGGTAGCGCGGAGAAGTTCCGCAAACACCCCAAACACGTCGATTCGAACGTTCTCTTCTCGCTCTTTAAAGCGCGAGATCAGAGGCTGGGCACAG
TGAATGTAGAGCTGCTCCAAAAGCTCTGGTCTGGTGGAGATAATTGCAGTCAACACGCGCAGACTAGCGCGGCGAACCTTCCAGCTGGTGTCATCGTCAT
CACTGTAGTCGCCTTCGTCATCGCTGTACTCCTCCTCTTCTTCTTCCATGTCCTCATCCTCGTCGGCAGAGTCAACGTAGTTGTAGTTCGGATCGTACGA
GATGAACTGCATCACCAGCTTCAGAATAGCTTCCACGTGGGGCGTGATCTCATTGTGACAGCGGATCACAAACGCTTCAAACGCCTGGAAGCAGTTGCCA
CGCAGCTCGTCTGAGTCTTCGTTTTGCAGTGACTCGTCCTCCGGGTCGCCACAAAACTGCACCAAGATGCGGATCACAGCGTCCAGGTGCTGTCCAAGGC
GGTGGCCGGCAGTGCGCGAGAGCATGCCGATGGTCTGGATCAGCGTGCGCACATTGGCGGAGTCGGTGGATCCCTGGATGCCCTTGATCAGGTGCTCCAC
CAGGCGGCTCACCAGCACATCCGACGCCATGACGCCGAGCGACCCGACGCAAGCTGTGGCGCGCTTGCGCACGAGCGGCGACTCGTCCGTGAGCTGCACC
ATCAGCAGCTCCATGATGGTCGCGTGCTCAGTGGCGACGTCGTAACCGAAGCGACGCAGTAGGTCCGTGAGGATGTCGAGCGTCTCAGCCTTCACCGCGG
CGTCCTTGTCCTTGCCCAGACCCGTCAGCAGCCGCGTGCAGACGCCAGTGGCGATGGATGAACCTGTAGGCTGTGACACGTCGGCCACGATGGTCTTGAG
GCCGATCGAGTAGATGTCCCGCAGCTCCGGCTTGCCGTTGAGGATGAGGTCGCAGAGCTTAGCGCAGATGTCCGCCACCTGCGTCACCTGCACTTTGGTC
ACGAGAATGCCCAGGCACTTGACGGCGATAGATTGCACGTCGTTTGACTTGTCGTCCAGCTGCTTCAGCACCGCCGCGCACACTCTAGAGCCATGCAAGC
AAACAAACAGAGAGAGAGAGCGAGGGCACGCAAACAGTCAGTTATCCGTTCCTTCCTCGCCTCCATCTCCCTCTCTACAGAGGACGCACTTGGGCTCGAG
GTACGCGCCCAGCTCCACATCCTTGTTGAGCTCGACGCAGAGATCCGATGTAGCCATGTAGCGCTCATCCTTGTCGAAGTCCGTGGTCTGCAGCGATACA
GAGAGAACAGACGTGAGCGCCGGCACACTACGCACACAGTCAGTCAGCCAGCCAGCCAGCCAGCCAGCACCTTGTCCAGCAGCTGCGCGATCTTGTCCTC
GTTCGCGCGCATGGCTCTTCCTCGCTCTCGGCTTCCGCGCGCGCTCTCCAAAGTGAAAGTGAGTGACGAGAGGAAAAAGGATCTCGTCTGTGGTGTACGC
CACACCAACTAGCACCCGACCGTTCCTTCAACTTCAGTCCGCAATTGGCTACATACCCGACGCCCATGAGTGCGACGCCGGACCTTGACGCTGTGGTGGA
TCCAGCGCGGGCGAGTACTGAACGATGCTCTGTGGCTCCGTGTGCAGGCGAAGGCGACGGCGACGGCGGCCAGGTGGCGCCTGACCGCGACCAGCTCACG
TCGCTCATCTCGGACGAGGTGGAGCGCCAGCTGCGAGAGCGAGGCTCCGTGCTCGAAGCCATGAGGGAGCAGATGGCCAAGGTGCTCGCGGAGTTCGAGG
AGATGGCGGCCAACGTCAGCTCCAAGCGCTCGTGGTCCAACAGCGTCGCCAAGACGAAACCCTTCGCGTCGCCCAAGTGGACGACGCCTTTCGACATCCA
CCCCGTTGTCACGCCCCTGGACATCGTCCCGCCGGCCGCTGCGTCGCCTCCACGCTTGCCAAAGTGAGTACGGTCATGCGTGCTTGTGCTGGTTTGTAGC
TCACTTGAAGTGTTGGTTTGTTTGCTTGTTGTCGGGTGCAGGATTGGCGGTGCGCTTCTCAAAAGCATCCACCAGCTCAAGCGCACTGCTAGTGGAGGGG
CGCTCCCACCAGCAGGGCCCCGTAGTCCCGACGGGAAGATCGTGATCGGTATGTATTGCTCGTGCGTCTAGTTGGCAGTATCTGCGCTGGATGCGGTTGT
TGTCCTGACTGCTTCGCTGCCCGACAGACAAGATACTTCCTCGGGTTGCCAACATTGAAAAGCGCGTCGATGGCTCGCAGATGATGCTGTCACAGCAGAG
AAAACAAATGTATGAGCGAGCTCTGGTGCGATATCCACAGTGTCGGAGCAATGTTTTCGCGCCCAGTGTTTTCGATTGGGAGGAAACGTCGAGCTCGGAT
TCGATTGCTGCGATCCAGGCACCGCGGGCGACCCTAGAGCTGGACTTTGTGTATGGATGCCGAAGTGGAGCGACGGCATCTCTTTCCAGCAGCCACCCTG
CAGCTCCCACCGCTAGCACTAACAACAATGCTTTCTATTTAGCAACTGGGGAGATGTTGTGGCTCACTGCGACTTTGGTGGTTCTCTACAAGAAGGAAAC
CAACACGCAGAGATATTTTCGAGAGCATACGAACGAAGTTACGAGCGTGACAGTCCATCCGAATCAACGCATTGTGGCATCGGGACAAGCCGGGCGCTCT
GCGTTTCTTCTTGTGTGGAATGCAAACGATGAGCCCCTAGGCAAACGATTCGCGTGCCTCAAGGGTCATCAAGTCGCGGTTCGCTCGATCAGCTTTTCTC
ACGATGGAAAGCTGATTGCTTCTCTCGGTGGCGACATGTACAACACGATTTGTATTCACGACTGGAAATCGCAGGAGCTACTGGTTAGCGCTCGGGGGCA
CACGTTTCGGGTGAACGCCATCGCATTCAATCCGTTTCAAGCATATGGTCGACCCGAAACACATCGGTCGAAGAAGCCTGGGCAGGCTCTACACGACGAC
GATGTTTGTTACACCCTAGTTAGCTGCGGTGTCCGGCATATTCGCTTTTGGACACTAACAAAAGCCGAGTACGTGCCTCCGCCATCGAAAGAAAATGCTG
ACAGTGCGTTTTCCCGCTCTACATTCGGTGGTCCTCCGAGGTTACGCCCTCCGACTCCGACCGAGAAAGTTTGGAAACTGGAGGGCAACGTCCCGTCATT
TCATGGGCGTTTTGAGGTCCAAGACTTTACCAGTTTGACGTTTGTCAACGATTCCCCACCTCTCTACTTGTATGATGAGCACTCAAAAGAGTTGGTCGCG
ACAAATTCCACTGACCACTCGCTAGGCCGGATCGTGGCAGGAACGGCGAGAGGAGATCTGTGTTTGTTCATCCAACCGAGAGCGAGCCCCAGTGTTGACA
TTATTTCTGAGAAGGATCTTCACAAAGAGCCTGCAAAATGGTGGGAGATTCCTGACGAATACACGGACGCTGAGATCAACGAGCTCGTGCTGGAGAGGAT
CTCCTACGAACCGACTGGGAGACTTGTCGATGTTGTACCCCATGACCAAGAAACCGGGAATCGGTTCAAGCTATCCAGGCAAGTTCAAGCGGAGATGGAA
GGGATCTCAAAGCGAATGGTGCTACGACCTAACTCTACAGCCTTAAATTCACGCTTGGGAGAGCTGAAATACAGTGGGCCGCTGGCCCATCAAGGTGCAG
CATACCAAGTTGCGTACTGCAAAAAGCTTAACGTGCTCATGTCATGTGGGAATGATGGAAAGCTACTGCTGTGGACATGCCAAATGAGTAGGCCCATTCG
AATTCCTGGAGTAAATACGCACGGGGTGTTCACACCGCTCACCGGAACGTTTGCAGAAGGCTCACACGCATTACTGCCTCATGGCGATCCTGCAAAAGTG
TTCCAGTTGCCGAACGAAACTAGCGCAGCCAAGCCTACTAGTATCGTGTGGAAAGAGGATGGCAGTTCTGTGCTAGTTGCCACTAGCACTAGCTGCATAT
GGGAACTAAATGTTGCAACCGGAGATTGGCAATTGCTTTTCGAAGCTCGCAGTTGTGCAATTGGCGCTTGTGCCGCTCATCCCATGAAGCTGGAGGTGGC
CACAGTTTCACAAGATGGATACCTTTGCTTCTGGGATCTTCAGCAGCATATGTGCACACGCCGAGTGTACCTTGGCACTTTCATCACCTCTAGTGTCAAA
GCTTTTTGCATGGAGTTCCATCCTGCGGGGCACGAGCTGACAATTGGTCTTAGTTCAGGAGAACTACTGGTTGTAGACTGCGACATACTCAAGGTTTTAC
TACGGAAGAACATCAAGTCAACCTCTGGTAGTACTACAAACCTGCATTTAGGCCTTTTGGGCCCTGGATTTCGAGCGGTTGCCCAAGTGAAGTATTGCCC
GAATGCAAAGTTCTTGGCCGTGGGTGTGAAGGATACGTTCGTGTATATCTACGATGTCGTGAATGTGTATAAGAAGCTTCATGTGTGTGAAGGCCACTCA
AGTGCAGTCTTGCATTTAACGTGGAACAAGAGTGGAGACATCTTGCAAAGCAATGCCGCCGATGGCGAGATTCTTCATTGGCTCGTTTCTCCGAACAAGG
GCGAAACTAAGCAAATTACTGATGCGTTCTTGGTTCGCGACGTGCAATGGGTTAGGTGGACGTGCGTGTTTGGATGGTCAACTCCCGGTATCTGGTCGGA
AGAATCGCCCCACCTTGTGGATATCGCAGCAGTATCGACTACGGGACCAAAAACTATAAGCGACCCAAGTGAATCAGGAAGTACTTGGACAACTTCCAGT
AGCGAAGATTTGATTGCCGTGGCATGTCGCTCTAGTGTTCACCTACTGAAGTACCCTGCCCACCGTGGGGCTCGGAGGAAGGTGTACAAGGCTCATTCAT
CGGCCATCGCAGCATTAGACTTCTCCTTCGATGACACCTATTTGGTTACAGTTGGTGGGGATGACGGAACGATCATGCAGTGGAAAGTTGCGTCTGGTGG
GGATACTTCCATTCGTGGTCGCGCTAAGAATAACACGAAACACACACCGAGGCTGCAATTCACGGAGGACGACAGCACTGGGGAACCGTGGCCAAACTCG
ATCCCTGTGCCTCCTCCGCACGACGAGAAGCAGCCGTCAAGCCAGCTTTCACCTCGAAAGAATTCGCGACAGTACCGCGAACGTCAAGTTTATCAAGAAG
CTGGCCTCGGCGCCGAAAGCCTGCACCAAAGCGCGGACAATGACGAGGTGTCAAACAGCACGCGCCCCGCGAGCTCTTTGGACGAGCTGAGTAGTTCCGC
TGGTGCGCGAGTTGAACGTGGAGTTAGCTACCAAATTCCCGGCGACCCACTGTCTGCACCTGTCCAAGTTCGGGTAACGCACGCCTACGCAGCGGAGAAC
TCAGACGAGCTGAGTCTAAACCATGGAGAGATCCTGCGCGTGCTGTCCAAAGCTGGTGGCGAGTGGTGGCTGGGCGAAACTTGCGATGGTATAAAGGGCT
ACTTCCCTGCTAGTTACGTAGAAGATATTGATCTCGGTACCCCCACTGCCCGTGACGAGGCAACTGAGGAGCAGGCAGCAGAAGGCTAATCCTTACTAAA
TCAAGATACCGTTTTGTTCGTTGAAGCTGTCTGCGACGTGTGAGATGAAATGGCTACAGTTTCGGTGGTGCTAGTCTACACTTTCTGGTCCCGAACCATT
CAATTGGTCATTCGTCATGGCCTCGGACACGGCGCTGGCTGCCAGCGCGACGACGTTCAGCGACCTCCCGCTGCATGGAGACGTCTCCAGGGCCCTCGGC
GCCATGCGTTTCCTGCGGCCGTCGCCCATCCAGCTGCACGCGCTGCCCGTGGCTCTGTTCGGCAACGACGTCATCGGCCAGGCCAAGTCCGGCACGGGCA
AGACCGCCGTCTTCGGAGTGGCGGCTATCGAGCACGCAATCCGCTTCGTAGAGCAAAGGCGGCGGGCTGACGGTGTTGACAAAGTGCCGCCCGTGGGAGA
CCCGTTGGTGCTGATTCTGGCGCCCACAAGAGAGATCGCGGTGCAGATCGAGACTGTGCTGCGTCAACTGGCGCAGTTCCGACCGGAAATTGTCATTCGC
ACATGCATCGGCGGTCTGCCCGTGGCTCAGGACCAGGTACTAAGAACGAGTAACAGACCCTGGTGTTGGTGTGGAGAGGCACTGATTGCCTTGGAGGTGC
TATCTACGACAGAAACACTTGGCTGCGGGCTGCCATATCGTGGTGGGTACGCCAGGACGCGTGAAGGCGCTGATCGATCAGTGTTCACTGCCTTGCAGTG
CGATTCGACTGCTCGTATTGGACGAGGTGGACAAACTTATGGCGCGAGATTTCGAAAAAGATGTACGAAGTGTCTTAGACGGCATGAAGCTGGTATTGTC
TTGACTATCTGCGATGTACTCCACAGATCCAGTTTATCGCAGACGCTCTTCCTGAGAGGCGGCAGGTGATCGAGCTTCGTGCTGTAGTGAAGTGTATTTG
GCAGTGTACTAACTCTCTTTACATGCTGCGTGGATCCAGACCCTTGCGTTTTCAGCTACGTTCACGCCTGACCAGTTGGTCGCAGTGGTGCAACTAACGA
GAACGCCGCAGGTTTGTAGACAAATGATTCCCGGGTATTTGTGCAATACTCCATAACAGTTTCTTACCGCAACTTCGATGTGGCAGATTGTGCGTGTTCG
CGGCCCTAATGATGTCACCACCGAGTTCATTTCTACTACTGAAGACCTAGAAAGCTGGAAAGAGCGCGAGCAAGCCAACGCCCCAGAGCTTTGGCTTCGC
CACGTGCGCCAGTTCTACAGCGTCGTCGAGCGCTCAGCCGCAATGCAATCAGGCGATGACGTACTGAATATGAAAGCGAAAGTGGTGAGGCTGGCGGCGC
TGCTGTCAGAAGTCGTGTTTGTGCAGTGCATGGTCTTCTGCAACGACAAATTCCGCGCTGAGGCGTTGGCTACTGCCCTCGCTGCACAGGGCTGGCCAGC
GGCGTGCATCACTGGATCACAGACCCAAGCTACTCGCCTGGAGGTGATGGAAGGTTTTCGCGCATCTCGCTCGCGTGTGCTGGTATCGACCGACCTCACT
GCACGAGGAATCGACGTCGACAAAGTGAATTTTGTGGTACGTATCGCCGCCGAGGAAGTGGATATGTCAACCTGTCTAACGCGTCGACTGTGAATTCGTA
GATGAACCTGGATCTGCCACGTGACCCAGCAACGTACTTGCATCGCGTTGGCAGGACGGGTCGCTTTGGTGGTAAGGGCTTGGCAGTGACGCTGCTGTCG
AGGAACGAGGTTCAAGGGGTTCAGCTACTCGCTCGAGTATTCAAGATGGAGATCAGCGAGTTACCGAGTCCCATTCCAGCAGAAATTTATGCGTACGCCA
CAGCAGCAGAAGAAGAAGGTAGTGGCGGTGATGAAGACCCTTCAGAGTCTGTTGGCGCAGAAGAGAAGTCGGACGAAGAGATTGAGGTCTGTGGAGAAGA
AGTGGAGAACACTACAACACCCATGGGGGAAAAGGTTATTGGAAGTGAGAACCTGTCGTCAAGTGAGGTTTCAGGCCGATACCTAAGGGAAGAACGCGCG
TATGAATCCTGGATAGAGTTGCTGTAGACGCATAACGGCAGTAAAGTAGCTCCACTTCCTAGCCGAATTTCTTGGCAATTCGACGCAAGGTGTTCGCCGT
TCGGACCGTGACGGGGACTCCTAGCTTCTTGTCGAAGGCCACTTTGAACAGCGGAGACTCGCTCATCTTCGTGGCCGAGTATCACACGAATTCCCTGTCC
AGCAGCTCGAGCTCGTCCGCGTCCGTGGACAGCGCCTCGAGGACGCCTCGTTGCTCCTGGGTGAGTCTTTCCTTCACCAGCACCACATTGACCGCCGTGG
CGGACTTGACAATCCGTTGCCCCAGCTGAGCCACCTCGTCCATGGAGCGGGCCAGCACCGGAATGTGGCCGCCGAATAGGTCCTCGAGCACGGCCTCGAC
TCGGTGTTCGAGCGCGAGCACCGAAGCTTCGTCGGGGGCGTCGAAAATGACGTTCCCGCTGGCCACGAACGTCTCGACGTTGGCGAGCCACGCCTTGCCC
AGCGCGTCTGCGATGGTCTTCATGCTGTGCACGCGACCCCCGACGTTGACGCCGCGCAGGAACGCCACGATCTTTTTGCTGCGGTTGGAGGGGTTCTTTT
CCGGCGCTGGAGCTTCGGCGGCGGCTGTATGTGCAGGAGGCCGGACGTCCTCAACGACAGCAGCAGCAGCAGCAGCGGTGCTGGAGCGCGTGACTCGCTT
GTTCTTGGGCTCCGGCACGGCCGGAGCCTTCCTCTTGGCCTTGGTGACCATGACGAGCTGCGGCGACTCTCCGAGTGGGACGCAGTGGCGATGCGAGTGG
CTGCTTGGACCTCCTCCAAGCCATTTTCCTCTGCCAACCGCGAGCACGAGCACCCAAAGCGAATCCACGCGGGGCTAATCGCGTCCAGCGTCCACCCTCG
TCCACCCTCGACCACCTCTGTAGTATCTGCAATACCTGTACTATCATATTTTATCAGATCTCACGACAACAACAGTGTCTGTATGTCCCGGCAAATGATC
GCTGAATCACCCTCTGTACCATCACCCGTCCAAGCCAATATTCACCGTTGTTCCGCCCTGTAGCGGCCAACTACTAGACGCATAACCGAACGCGCCTCGA
GGCCCGAAAGCTTCCTGCTTCAAGCTCTCTCTCTCTCTGCCGAGGCGTCGCCTTCGCCTTCGCGGGGCACACAGCACCAGCCCACACCCAATCTTCGCCG
CTCGCTGCGACGCCATGACCACGGGCAGCACGCCGTCGGTGTCGTCGGCGGCGGCCACTGCGTCCTCCTCGGCCGACAACAACGCGGCGTCCGGCAACCC
GCTGCACAAGTACATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGCCAGCAGCACGACCTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGC
GGCCGCGAGACCGCGTCCAACCCCGCCGCGGCCGGCGCCACGGCCTCGGCCGGAGCCATGTCGGCGTCCAACAGCCCGCGCTGCTCGTCGCCCATGGCCG
AGTCGCCCATGGCCGAGTCCATCCTCAAGGTCGTGCTCATCGGCGACTCGGGCGTGGGCAAGTCCAACCTCGTCATGCGCTTCACCAAGAACAAGTACAT
GCCGCACAGCGTGCAGACCGTGGGCTTCGAGTTCGCTACCAAAACCATCCGCGTCGGCGACCGGCGGCTCAAGGCGCAGATCTGGGACACGGCCGGCCAG
GAGCGCTTCCAGTCGCTCACGGCCGCCTACTACCGCAACGCCGTGGGCGCCATGATCGTCTACGACATCACGAACCGCAGCTCGTTCGAGCACGTCACGG
GCTGGCTGGCCCAGGTGCACGAGCACTCGCACGAGAGCCTCGTGCTCATACTCGTGGGCAACAAGTGCGACCTGGCCCACCTCCCAGAGAGCAGAGAGGT
GTCCACACTCGAGGCGGCGAGGTTTGCGGCCAAGCACTCGATGGAGTTCCTGGAGACGTCCGCGCTGGACTCGACCAACGTCGTCGACGCCTTCAAGAAG
CTGATCGTGCCGGTGGGGCGCTTGCTGTCGCCCACGGAGCCCAAGAAGATCGCGCGACTACCGACAGGATGGAGACGCGTGCTATCAAGGACCAGGCCGG
GCGAGTATTCGTACGAGAACCAGTACACCAAGGAGCGGATCTCGTTCGCGCCCAAAGAACCGGCCAAGCCGTCGCAGCAGAGCTTCCGAGCGCCTGCGAA
CGGGTCCAAGAGCGGGTCCCCGAGCGTCGTCACGGTCACACGGGAGAGCCTGCAGAGGCAGCACCAGAAGGCATACCTCGCACAGAACCAGACCCCGCAG
TGCGGAGTCTGCGCATTCAACTGCACCATAATGTAGTCATCGAGCAGACGATGGACGGCTTGCCTCTTGGTCATCGGGCCACGGGCAACCCGTTCGTTTC
CCCTCCACCAAGCCCAACACAGTCAATTCCGGTCTGCGTGCTGGCCCAAGACGAGATCAACACAAGTCGACGAACTATGTGAAACAGTCGCAAGTGTGAA
GATGAAGGATACAGGGTCGAATAGAAGCAGGCTCACTCGTTGGACATGCATTTTCAGTATAAGGTCGTGCTGCTGTGTGGGTAGCAGCGATCTCTTTGTC
ACCAAACGCGTTGGCAAACACCTTGGCGATAAATTAACTTGTTCCCTTGCGGCCGACTTGCCAGTAGCGATAATAAGCAGCATGAACATGGTTTCTTCAC
ATTGTTTTCTCTATGTAGGTTCCATTCGTGATGGTTTCACTAACGACGCACTGCTGCTACTGCTGCACAGCATCATGACGCGCTATTTACTTGGAACGAC
GTGCCACCAAGAACGCGGCGGCGACGGTGGCAGCAGCAAGCGCAAACGTAGCCAGCTTGCACTCGGTGGGAGCGGATGCCCAGAGGCTGAAGCAGTTGCT
GCAGGCCTTCTGGTTCTTCTTCGCGATAGTCTTGCGAATGTGCTCGGCAACGGTGGCGCTCGAGTTGTTGGCAACCGCTAGTCGGGTGGGGAGCGACTCG
AGCGACTTCAGGATCGGGTGCTGCTGGATCTCAGTCTCAGCAACGCCAAGCGCCTTCGACACGACGGGCAGGAACTTGCCGTAGTGAGCAGTACCCACGA
CAACCACAGCCGAGTCGGGCTTATCGGCGAGCGCGTCCTGGCCGTAGTGCATGGCAGCAGCGGCGCCAATGGCGCTGTGCGGGTCGTAGAGGTAACGGTG
CACCTTCTTATACTCGGCGATGGTGGAGCACACCTCGTCCTGCAGCACAGCGTACGAGGCCATCTCGTTCTGTGCCTTGGTGAGCAGCTCGCCCGAGATC
GTGAGCTCGTTCGTCTGCTCGAAGCCCTGCATCCAGCCGCGCAGGACGTCGTGGTTCTCGCCGCTCAGCGCGAAGAGGTAGCGCTCAAAGTTGCTGGACA
CGCAGATGTCCATGGACGGCGAGATGGTGTGCTCGATGTCGCGGCGGTGGTACTTGCCCGTGGAGAAGAAGCGGTACAGGATGTCGTTCTCGTTGGTGGC
CACAATGAGCTTGCCAACGGGCACACCCAGCTTCTTGGCGTAGAAGCCGGCGAGGATGTCGCCGAAGTTGCCCGTGGGCACCGAGAAGGCGACCTCGCCG
GTGACGCCCTGCTCGCGGGCGCGGAAGTAGGCCCAGACGTAGTAGACGATCTGCGCCAGGATGCGCGCGAAGTTGATGGAGTTGACGGCGCCCAGGTGGT
ACTTGGCCTTGAACTCGGCGTTGGCGAACAGGTCCTTGACGATGGCCTGGCAGTCGTCGAACGTGCCCTTGACGGCCACGTTGTGGATGTTCTCGTCCAG
CACCGTGGTCATCTGGCGCTGCTGGATGGCGCTCACGCGGCCCTCCGGGAAGAGGATGAACACCTCCACGTTCTCCTTCCCGCGCAGGCCGTAGATAGCC
GAGCTGCCCGTGTCGCCCGACGTGGCGCCCACCACCGTGATCTGGTGCTTGGGGGCGCCCGCCTTGTTCTTGCGCTGCAGGAAGAACTCGAAGAGGTTGC
CCAGGAACTGCAGCGCGATGTCCTTGAAGGCGAAGGTCGGGCCGTGGAACAGCTCGAGCACCAGCATCTGGTCCGTCACCTTGACCACGGGCGCCACCTC
CTCGGCGCGGAACGTGCTCGAGTTGTAGCTCTTGGCCACGAGCGCGCGCAGCTGGGCGCGCGAGATCTCGCTCTCGTCGATGAACAGGCCCATGACCTCC
ACGGCCAGCTCCTGGTACGACAGCGACGCCCACTTGTCCAGCGCATCGGCCGGCAGCGTCGGGAACTCGCCGGCCTCGGGCACCAGCAGGCCGCGGTCGG
CCGCCAGACCCGTGAGCACCGCCTGCTCGAAGCTGAGGCCGCGGACGCCGCCGCGCGTGCTACGGTAGTGCACCATCGTGTGTGTGAGAAGCAAGTAAGT
AAGTGTGTGGGGGCTGTGGGGGTGAGAGCGCAAGTGGCCGCGTCAGTCCAAATCTGCGTGGCACGCGAGCCCTGGGAAACTTCTTGCAGTGTAGGCGCCT
GGAATTGGCGTAACATTCGCGCGACATTCTGTACGTTGCGCAAACGG