Description :
From Genome Similarity Track
Location :
Scaffold_1:95761- 97703
Transcript NameFunction/comments
Sapdi_VS20SDRG_00033hypothetical protein

Sequence
1942 bases(100 bases per row)
CATGTCGTCGCTCTTCCAGGCGTGGCAGCTTCAAATTGGTGGTTGGGATCAAAGCATTTCTCAAGCGGCGTGTCGTCGAGTACTTGGACAGTCTCCCACG
CTCGGCCGTGCTGCTGCCACCGAGCAACGCGGTCACGGCAGCCCGGCACGCGGCCATCGCTGCCATTCACAGTCGACTCGGCGCGCCGCCACCGTCAGTA
GCAACGAGCGAGACGGCGCCCCCGGTGGCCGCCGACGTGACACTGGCGCCGCCGACCGCTGTACGAAGAAAGCGCAAGGCACCACCAAAGCGCCAAACAG
CACGGAAAGCCAAGCGCAAGGCGGCGACGAGTGCCATGTGCAAGTACTGCTTTGAGATGGGCCATGCGACCATCGCCTGCAGCGACCTCCGTGACGACTA
CATCCATGGCACCGTTCGCGACGGCTTTGTTTTGCGGAGCGACTATGGCTGCGTGTGGTGCCGAAGCCGGGGTCTTCGCAGCGTCCACCGCGAAGACCAC
TGCGCGATCTATCGAGGAGTGGCCGACACGAACTGGTCGCCCAGATGGCCACCGCGGTCAATATCCCTTGTGTCTAGTTGGTTGAGTGGAATTTATGTAA
AAGACGTTATATGGACTACGTCTAGCGCGATACCCAGAGGCTCAGGTACCGAGCGCTGCACTTTGACGCGTCGTCACGGGAGCTACTGGTCCACGCTGTG
TCGCACGCAACCTATGACGAGCCTGTCCTTCCGTGCGATGCTCAGACCTGCAACGGCGACTGCAGTTGTCAAGCTGGCAGAGCTTGCTCGTTGGCGCCGA
ATGCCATTTTGAACTCGGTTTTTGAATGGACGTCGGCAGATCGTTATTCCCACCTGCATGAGGTCGCCCTCGAGATGCAAGATATCGAAAAGGCTTGCAC
TCAACATGCAGCGGGCGTGGCTCTCGGAGAGGAGTGTGGTTGTCAACGTAGCATTTTCTAAAAGGCGTCTGGACGGAGCGACGCCGCCGCCACTTTACAC
CCGTTGGTGTCGGAGTTTTGCGCCGAGACACGTCGAATAGCAAGCGCAAGGCAGCGCCCGCAGCGGACGAAGCCGCGTTCGGTGCATCAACCCTTCAACC
AGGTCGCGTCCGCGCGCACGTTGAAGTTGCAATAGCCAATCACAGCGCTTTTGAATCCGGTCAAGTGACACGTTTTTCTGCAGTGCATCTTGGCGGTACG
CGACACAGACTCTCCCGGCTGCACGCGGTGTTTCAGCCTGCTGCACGCGGTGTTTCAGCCTGCTGCACGCTTGGGGTCGTCCAGAGATGCCAGTGCTCCG
CCTGCCCGTCGCGCGTCGCATCGATGCTGCCGGTCGCGTGACCTCATTTTCAGATGAGTCTTTGAGCTCGAGAGTAGGACCATGATCCCCAACGCGGTCG
GCGGCGTGTCGCAGCGACGTCGCCAGCACCACGAAAACCTCTACAAACGCATCTTCAACTGGTGTAATTGCTTGAAGTCGACACTCAGTTTGAATTTGCC
TTTGTTGCGCGCACCCCACCCCATCACCAACTACGATACAATGACCTCGATCAACTGGACCGAGCTGGAAGCCGCGGCCAAAAAGGCGTCGCTGGCGGCC
TACGCGCCGTACAGCCACTTCCACGTCGGCGCCGCGCTGCTGACGTCGGACGGCCAAGTGTTTGCCGGCTGCAACGTCGAGAACGCTTCGTACCCCTTGG
GCAACTGCGCCGAGCGCACGGCCGTGTACGCGGCGCGCGTCCAGGGCAACATGACGCACATCGAAGCCATTTGCATCTACACGCCGACCGAGAAGGCGAC
GTCGCCCTGCGGCGCGTGCCGCCAAGTGCTCAACGAATTTGGCCCGAACATGGTCGTCCGCATGATCTGCGACGGCGACGAGGTGCTCGAAACGACGATC
GACCACCTTCTTCCGTACGGCTTTGGCCCCAAGAACCTGGAA