Description :
From Genome Similarity Track
Location :
Scaffold_23:95760- 97061
Sequence
1301 bases(100 bases per row)
CTTGCCGGCTTGTACTCGACGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCA
AGGACGCGTGGTCTGTGTAGATCACAAAGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGGGCTCCTTGTCATG
GACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATG
GCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAG
CATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAG
GTAGTTGGCCAAACCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCC
ACGTTGCTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACA
CTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACG
CAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGA
GTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGT
TGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGCTATAAGCGTGAACCAGACGCCACTTTCCGTTCGG
CTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCAC
TGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCG
G